ID: 988995067

View in Genome Browser
Species Human (GRCh38)
Location 5:36706835-36706857
Sequence GCTGCACATTGGAATTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988995061_988995067 4 Left 988995061 5:36706808-36706830 CCAGATGGCAGTGGTTCTCCAAC No data
Right 988995067 5:36706835-36706857 GCTGCACATTGGAATTCCTTGGG No data
988995056_988995067 27 Left 988995056 5:36706785-36706807 CCGGAGAGTTCACCTCTCTCTTC No data
Right 988995067 5:36706835-36706857 GCTGCACATTGGAATTCCTTGGG No data
988995058_988995067 15 Left 988995058 5:36706797-36706819 CCTCTCTCTTCCCAGATGGCAGT No data
Right 988995067 5:36706835-36706857 GCTGCACATTGGAATTCCTTGGG No data
988995060_988995067 5 Left 988995060 5:36706807-36706829 CCCAGATGGCAGTGGTTCTCCAA No data
Right 988995067 5:36706835-36706857 GCTGCACATTGGAATTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988995067 Original CRISPR GCTGCACATTGGAATTCCTT GGG Intergenic
No off target data available for this crispr