ID: 988995069

View in Genome Browser
Species Human (GRCh38)
Location 5:36706860-36706882
Sequence TCTTTCAAAACACTGAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988995061_988995069 29 Left 988995061 5:36706808-36706830 CCAGATGGCAGTGGTTCTCCAAC No data
Right 988995069 5:36706860-36706882 TCTTTCAAAACACTGAATCCTGG No data
988995064_988995069 11 Left 988995064 5:36706826-36706848 CCAACCTTGGCTGCACATTGGAA 0: 5
1: 5
2: 52
3: 143
4: 421
Right 988995069 5:36706860-36706882 TCTTTCAAAACACTGAATCCTGG No data
988995060_988995069 30 Left 988995060 5:36706807-36706829 CCCAGATGGCAGTGGTTCTCCAA No data
Right 988995069 5:36706860-36706882 TCTTTCAAAACACTGAATCCTGG No data
988995065_988995069 7 Left 988995065 5:36706830-36706852 CCTTGGCTGCACATTGGAATTCC No data
Right 988995069 5:36706860-36706882 TCTTTCAAAACACTGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988995069 Original CRISPR TCTTTCAAAACACTGAATCC TGG Intergenic
No off target data available for this crispr