ID: 988995522

View in Genome Browser
Species Human (GRCh38)
Location 5:36711358-36711380
Sequence GAAAATGCTGCTATTGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988995522_988995526 2 Left 988995522 5:36711358-36711380 CCCATTTCAATAGCAGCATTTTC No data
Right 988995526 5:36711383-36711405 CCTTCACTCCTGGCCTACAGAGG No data
988995522_988995524 -8 Left 988995522 5:36711358-36711380 CCCATTTCAATAGCAGCATTTTC No data
Right 988995524 5:36711373-36711395 GCATTTTCTACCTTCACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988995522 Original CRISPR GAAAATGCTGCTATTGAAAT GGG (reversed) Intergenic
No off target data available for this crispr