ID: 988999119

View in Genome Browser
Species Human (GRCh38)
Location 5:36742842-36742864
Sequence CTGACTTCAAAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988999114_988999119 -8 Left 988999114 5:36742827-36742849 CCTGCCTCTGCCTTGCTGACTTC No data
Right 988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988999119 Original CRISPR CTGACTTCAAAGATGGAGGA AGG Intergenic
No off target data available for this crispr