ID: 988999850

View in Genome Browser
Species Human (GRCh38)
Location 5:36748814-36748836
Sequence GACCCTCTGCTTGTCTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988999846_988999850 -10 Left 988999846 5:36748801-36748823 CCCCCTATGTGAAGACCCTCTGC No data
Right 988999850 5:36748814-36748836 GACCCTCTGCTTGTCTCCACAGG No data
988999844_988999850 11 Left 988999844 5:36748780-36748802 CCTTCTACGCTCACTGATGGCCC No data
Right 988999850 5:36748814-36748836 GACCCTCTGCTTGTCTCCACAGG No data
988999845_988999850 -9 Left 988999845 5:36748800-36748822 CCCCCCTATGTGAAGACCCTCTG No data
Right 988999850 5:36748814-36748836 GACCCTCTGCTTGTCTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988999850 Original CRISPR GACCCTCTGCTTGTCTCCAC AGG Intergenic
No off target data available for this crispr