ID: 989005336

View in Genome Browser
Species Human (GRCh38)
Location 5:36804646-36804668
Sequence TAGGGACTCGGGGGAGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989005336_989005347 19 Left 989005336 5:36804646-36804668 CCTGGGACTCCCCCGAGTCCCTA No data
Right 989005347 5:36804688-36804710 CAGACATGCCTCCTTAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989005336 Original CRISPR TAGGGACTCGGGGGAGTCCC AGG (reversed) Intergenic
No off target data available for this crispr