ID: 989017952

View in Genome Browser
Species Human (GRCh38)
Location 5:36962253-36962275
Sequence ACACATCCACAGATGCAACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 207}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989017946_989017952 20 Left 989017946 5:36962210-36962232 CCCTGCAGGATACATGCCATATT 0: 1
1: 0
2: 0
3: 13
4: 350
Right 989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG 0: 1
1: 0
2: 0
3: 14
4: 207
989017948_989017952 4 Left 989017948 5:36962226-36962248 CCATATTCCCATCCTTCAAGTTA 0: 1
1: 0
2: 0
3: 16
4: 227
Right 989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG 0: 1
1: 0
2: 0
3: 14
4: 207
989017943_989017952 30 Left 989017943 5:36962200-36962222 CCCCACAAAGCCCTGCAGGATAC 0: 1
1: 0
2: 3
3: 19
4: 201
Right 989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG 0: 1
1: 0
2: 0
3: 14
4: 207
989017944_989017952 29 Left 989017944 5:36962201-36962223 CCCACAAAGCCCTGCAGGATACA 0: 1
1: 0
2: 2
3: 29
4: 185
Right 989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG 0: 1
1: 0
2: 0
3: 14
4: 207
989017950_989017952 -4 Left 989017950 5:36962234-36962256 CCATCCTTCAAGTTACACAACAC 0: 1
1: 0
2: 0
3: 10
4: 181
Right 989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG 0: 1
1: 0
2: 0
3: 14
4: 207
989017945_989017952 28 Left 989017945 5:36962202-36962224 CCACAAAGCCCTGCAGGATACAT 0: 1
1: 0
2: 2
3: 18
4: 210
Right 989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG 0: 1
1: 0
2: 0
3: 14
4: 207
989017947_989017952 19 Left 989017947 5:36962211-36962233 CCTGCAGGATACATGCCATATTC 0: 1
1: 0
2: 0
3: 9
4: 148
Right 989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG 0: 1
1: 0
2: 0
3: 14
4: 207
989017949_989017952 -3 Left 989017949 5:36962233-36962255 CCCATCCTTCAAGTTACACAACA 0: 1
1: 0
2: 0
3: 9
4: 153
Right 989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG 0: 1
1: 0
2: 0
3: 14
4: 207
989017951_989017952 -8 Left 989017951 5:36962238-36962260 CCTTCAAGTTACACAACACATCC 0: 1
1: 0
2: 0
3: 18
4: 151
Right 989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG 0: 1
1: 0
2: 0
3: 14
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989017952 Original CRISPR ACACATCCACAGATGCAACA AGG Exonic
900522867 1:3114668-3114690 ACACATGCACACATGCACCCGGG + Intronic
900761882 1:4478104-4478126 AGGCCTCCACAGAAGCAACATGG - Intergenic
902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG + Intergenic
904395121 1:30215058-30215080 ACACAGCCACAGCAGCAACGAGG + Intergenic
906810060 1:48817579-48817601 ACACATGCATAAATGGAACAGGG - Intronic
912205379 1:107502540-107502562 ACCCAACCACAAATGCAATAAGG + Intergenic
912634588 1:111280041-111280063 ACACTACCACTGAGGCAACATGG + Intergenic
915065501 1:153221109-153221131 CCACAGCCACAGAGGCCACAGGG + Intergenic
916967100 1:169959268-169959290 ACACATCAAGAAATGCTACAGGG + Intronic
917019556 1:170570861-170570883 ACACATAATCAGATTCAACAAGG + Intergenic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
919369974 1:196710669-196710691 ACACATTCACAGATGAATCTGGG + Intronic
919436415 1:197567721-197567743 TCACATCAACAGATGCACAAAGG + Intronic
920159365 1:203984263-203984285 ACACAGCAACAGATCCCACAGGG - Intergenic
924209893 1:241753876-241753898 CCACATCCACAGATGGGATATGG + Intronic
1063106893 10:2999882-2999904 ACACACACACACATGCAGCATGG + Intergenic
1063599952 10:7471895-7471917 ACACATACACACATACAGCATGG + Intergenic
1064943422 10:20760395-20760417 GCACATCCACAGATTCAGCTGGG - Intergenic
1067356739 10:45535464-45535486 ACAGAAACACAGATGCAAGAGGG + Intronic
1067448483 10:46367313-46367335 ACACAGCCTCAGAAGAAACAGGG + Intergenic
1067588891 10:47493452-47493474 ACACAGCCTCAGAAGAAACAGGG - Intergenic
1067636019 10:48001543-48001565 ACACAGCCTCAGAAGAAACAGGG - Intergenic
1068981058 10:63062579-63062601 AGAAATACACAGATGCAAGAAGG + Intergenic
1070132583 10:73665551-73665573 ACACAGCCTCAGAAGAAACAGGG - Intergenic
1070365232 10:75730331-75730353 ACAGATCAACAGATGCACAATGG + Intronic
1071609100 10:87018524-87018546 ACACAGCCTCAGAAGAAACAGGG + Intergenic
1073467684 10:103703846-103703868 ACACATGCACACACGCACCATGG - Intronic
1075271129 10:121052088-121052110 ACACATACACAGATGGCAGAGGG + Intergenic
1075456377 10:122587650-122587672 AAACACCCCCAGATGCAGCAGGG + Intronic
1075739745 10:124687565-124687587 ACTCAGCCAGAGCTGCAACAGGG + Intronic
1076358727 10:129871375-129871397 AGACATCCACAGCAGCAGCAGGG + Intronic
1076646181 10:131956413-131956435 ACACATCCACAGAGTCCACCTGG - Exonic
1078316901 11:10301846-10301868 ACACATACACATATGCTAAAGGG - Intergenic
1078500092 11:11864700-11864722 ACACATACACAGTTTCAAAAAGG - Intronic
1079733180 11:23961927-23961949 TCCCATCCACAGATGCAATTTGG - Intergenic
1079941975 11:26692323-26692345 ACACTTCCAAAGATCCAGCAGGG - Intronic
1081491605 11:43573743-43573765 GCACATTCACAGAAGCCACATGG - Intronic
1082234622 11:49808768-49808790 ACACAGACACAGATACAAAAGGG - Intergenic
1082726224 11:56740230-56740252 ACAGATCCAGGGATGCAACTGGG + Intergenic
1087083812 11:94197044-94197066 GTACATTCACAGAAGCAACAAGG + Intergenic
1089270621 11:117299462-117299484 GCACAGCCACAGAGGCACCACGG - Intronic
1089956290 11:122574402-122574424 ACACATACATAGATGAAAGAGGG + Intergenic
1091218191 11:133916413-133916435 ACACATGCAAAGGTGCAGCATGG + Intronic
1091933842 12:4419025-4419047 CGAGATCCACCGATGCAACAGGG + Intergenic
1095780426 12:46052984-46053006 ACACTTCTACACATGCAAAATGG + Intergenic
1096897837 12:54841616-54841638 ACACATACACATAGCCAACAAGG - Intronic
1099215407 12:79847045-79847067 ACACGTCCACAGAGGGAAAAAGG + Intronic
1099301095 12:80895430-80895452 ACGCATCCAAAGCTGGAACATGG + Intronic
1101503242 12:105323994-105324016 GCACATCCACAGATATAAAAGGG + Intronic
1101735720 12:107461363-107461385 ACACAGACACAGATGGAAGAAGG + Intronic
1102561189 12:113763267-113763289 ACACATGCACACATGCACAAGGG - Intergenic
1103156888 12:118693120-118693142 AGAAAGCCACAGATGAAACAGGG + Intergenic
1106766709 13:32920582-32920604 ACACATGCACAGGTGTATCAGGG + Intergenic
1107166817 13:37292013-37292035 ACAAATACATATATGCAACATGG - Intergenic
1107473292 13:40711318-40711340 ACACATCGTCAGATTCACCAAGG - Intergenic
1111040494 13:82740872-82740894 ACACATCAACAGGTGACACAGGG + Intergenic
1111220324 13:85196809-85196831 ACAAATACACAGATGGAAGATGG + Intergenic
1111271711 13:85895451-85895473 ACACCCTCACAGATGCAACCAGG - Intergenic
1111940996 13:94606618-94606640 ACTCATCCATATATGGAACATGG + Intronic
1113445032 13:110359359-110359381 ACACCTTCACACATGCAAGATGG - Intronic
1113701240 13:112390165-112390187 ACACATCCAGTGGTGCAAGAGGG + Intronic
1114377263 14:22160678-22160700 ACACACACACACAAGCAACAAGG + Intergenic
1115437070 14:33387266-33387288 ACACTTCCACAGAGGCAGCTTGG + Intronic
1116977187 14:51129408-51129430 TCAGATCTACAGATGCAAGAAGG + Intergenic
1117100214 14:52338253-52338275 CAACCTGCACAGATGCAACAAGG + Intergenic
1117791684 14:59348633-59348655 GCACACCTACAGATGCAACCTGG - Intronic
1120343431 14:83251886-83251908 ACACATACACAGATTGAAGAAGG + Intergenic
1121161948 14:91751620-91751642 AGACATCCAAAGATTCAAGAGGG - Intronic
1121245705 14:92459621-92459643 ACACATCCGCAGACGCACAAAGG - Intronic
1122426060 14:101606227-101606249 GCTCATCCACAGATGGGACATGG + Intergenic
1123715025 15:23021623-23021645 ACACATCCACAGAAACAAAGTGG - Intronic
1124242051 15:28037003-28037025 TCACATCCACAGATTCTCCAAGG + Intronic
1125329311 15:38566276-38566298 TCACAGCCACAGATGCAGAAGGG + Intergenic
1127178307 15:56385247-56385269 ACAACTCCACAGTTACAACAAGG - Intronic
1127257451 15:57304186-57304208 ACACATCCAAAAATGCAACCTGG - Intergenic
1128022103 15:64400864-64400886 AAACAACCACAGACGCAACAAGG - Intronic
1129385708 15:75195278-75195300 CCACACCCCCAGATGCAAAAGGG + Intergenic
1131444389 15:92484939-92484961 ACACACACACATATGAAACAAGG + Intronic
1132308426 15:100836094-100836116 ACAAATGCACACATACAACATGG + Intergenic
1133378060 16:5306038-5306060 ACACATACACAAAAGCAACTAGG + Intergenic
1135039108 16:19104267-19104289 ACACACACACACATGAAACAAGG - Intergenic
1138219734 16:55240479-55240501 ACAGATCAACAGATGAAATATGG + Intergenic
1140458170 16:75116488-75116510 ACCCACCCACAGTTGCCACAGGG + Intronic
1143805837 17:9425937-9425959 ACACACACACAGCTGAAACATGG + Intronic
1147213187 17:38884057-38884079 AGACATCAACAAAAGCAACAAGG - Intronic
1147268794 17:39252011-39252033 ACACAAACATAAATGCAACAGGG - Intergenic
1148223396 17:45881226-45881248 ACACATTCACAGGTCCCACATGG + Intergenic
1148497004 17:48059038-48059060 CCACAACCACACATACAACATGG + Exonic
1148892691 17:50819606-50819628 ACACCTCCTCAGTTGTAACAGGG + Intergenic
1149088347 17:52748283-52748305 ATACATATACATATGCAACAGGG + Intergenic
1155098464 18:22584064-22584086 AGACATTCACAGATTCCACACGG + Intergenic
1155867663 18:30985803-30985825 ACACATGCACATATGCAAGCAGG - Intergenic
1157412598 18:47476229-47476251 ACACCTCAACAGAGTCAACAAGG - Intergenic
1157562168 18:48656025-48656047 ACACATGCATGAATGCAACAAGG - Intronic
1159957319 18:74528828-74528850 ATAAATACACAGAAGCAACAAGG - Intergenic
1160227003 18:77019390-77019412 ACACAGCCACAGATGCACAGGGG + Intronic
1162224101 19:9205367-9205389 CCACATTCACATATGAAACATGG - Intergenic
1163775330 19:19213960-19213982 ACACATCCACAGATCACACTAGG + Intronic
1165602488 19:37066977-37066999 AAACACCCACACATACAACATGG + Intronic
1166284022 19:41812432-41812454 ACACATCGTCAGATGAGACAAGG + Intergenic
1167017004 19:46847637-46847659 ACACATCCACAGAGACAGAAAGG - Intronic
1167124803 19:47542179-47542201 ACACATCCACAGAGACAGAAAGG + Intronic
1167980860 19:53273599-53273621 AGACATCCACAGAAGCAGGAAGG - Intergenic
925128642 2:1478798-1478820 ACACATCCACACAGGAAACACGG + Intronic
926533223 2:14078346-14078368 ACAAATCCAAAAAAGCAACATGG + Intergenic
927422585 2:22948749-22948771 ACAGGTCCACAGATGGAATAAGG + Intergenic
929372380 2:41241793-41241815 ACAGATCCTCAGATGGAACCTGG - Intergenic
930612147 2:53555022-53555044 ACACACCCACTGCTGCCACAGGG - Intronic
931249844 2:60520655-60520677 GCACAACCACAGAAGCACCAAGG + Intronic
931384405 2:61784802-61784824 ACACATGCATAGAAGCAATAAGG - Intergenic
934030861 2:88045403-88045425 AAACAGCAACACATGCAACACGG + Intronic
935372401 2:102360967-102360989 ACACATCCACATTTGCAGAATGG + Intronic
935440280 2:103085901-103085923 TCACATTAACAGATGCAAGAGGG + Intergenic
935832456 2:107014579-107014601 ACACACTCACAGATACAACCAGG - Intergenic
935888837 2:107653535-107653557 ACACACACACAGATACAAAAGGG + Intergenic
941307701 2:163891890-163891912 ACAAATCCAAAAATCCAACAGGG + Intergenic
942067347 2:172284242-172284264 ACCCCTCCACCGATGCAGCATGG - Intergenic
942226964 2:173825088-173825110 ACACACACACACATGCAAAATGG - Intergenic
943717205 2:191165400-191165422 ACACAATCACAGATGCCAAAAGG - Intergenic
945205807 2:207330967-207330989 AAACTCCCACACATGCAACATGG + Intergenic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
947406665 2:229785125-229785147 ACAAATTGACACATGCAACATGG + Intronic
948532179 2:238616069-238616091 ACTCATCCACAGCTGTGACAAGG - Intergenic
948703372 2:239774648-239774670 ACACAGACACAGATGTGACATGG - Intronic
1168774958 20:439728-439750 ACAAATCCACAGATGCTCAAGGG + Intronic
1172663356 20:36582634-36582656 ACACATCCACAGGTCCCACCTGG + Intronic
1172830907 20:37833557-37833579 ACACACACACAGAAGCAACAAGG - Intronic
1172876367 20:38166721-38166743 AAATATCCACTGAAGCAACACGG - Intergenic
1175594388 20:60219146-60219168 ACACATACACCGGTGGAACAGGG - Intergenic
1178340212 21:31779550-31779572 AACCATCCACAGACACAACAAGG - Intergenic
1178548982 21:33519206-33519228 ACACATGTGCAGATGCAAGATGG + Intronic
1179121167 21:38547250-38547272 ATAAATCCATAGCTGCAACATGG - Intronic
1180797739 22:18615068-18615090 TCACATGCACGGATGCAATAGGG - Intergenic
1182523936 22:30903755-30903777 ACACAAACACACAGGCAACAGGG - Intronic
1182524507 22:30907008-30907030 TCCCATCCACAGATGCAGGAGGG + Exonic
1183040671 22:35175516-35175538 ACAGACCCACAGAGGAAACAAGG - Intergenic
949218067 3:1595660-1595682 ACACAGGCACTGATGCAACAGGG - Intergenic
950483589 3:13259762-13259784 GGTCATCCACAGATGCCACAAGG + Intergenic
950814851 3:15690088-15690110 GTACATCCACACATTCAACATGG + Exonic
953137772 3:40198110-40198132 ACACCTCCCAGGATGCAACATGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
954630549 3:52045522-52045544 ACACATGCACGGAAGCTACACGG + Intergenic
954888056 3:53894080-53894102 ACACATGAGCAGAGGCAACAAGG - Intergenic
954896089 3:53976209-53976231 ACTCTTCCACACAGGCAACACGG - Intergenic
955463114 3:59207460-59207482 ACACATAAAAAGAAGCAACATGG + Intergenic
956852095 3:73238258-73238280 ACATATCCACAGACTCAAAAGGG + Intergenic
958764896 3:98355396-98355418 ACACATACACACATGCAAAGAGG + Intergenic
959044519 3:101457813-101457835 ACACATGCGGAGATGCAAGACGG + Intronic
959175187 3:102899794-102899816 ACACACACACAGATGCACAAAGG + Intergenic
959220647 3:103514446-103514468 TGACATCAAAAGATGCAACATGG - Intergenic
960208649 3:114933253-114933275 ACACAGCCATAAATGAAACAGGG + Intronic
962343665 3:134604886-134604908 ACACTTAGACAGATGCTACAGGG - Intronic
963358219 3:144237374-144237396 ACAACTCCACGGATGCCACATGG - Intergenic
964511758 3:157460283-157460305 ATTCCTCCACAGAGGCAACAAGG - Exonic
964704423 3:159602882-159602904 ACACTTCCACAGATACCACCTGG + Intronic
969170269 4:5356612-5356634 ACACATCCAAATTTGCAACCAGG + Intronic
972348978 4:38218315-38218337 AAACATCCTGAGCTGCAACATGG - Intergenic
975492047 4:74999970-74999992 ACACACCCACAGATGCATCCAGG - Intronic
976382025 4:84410336-84410358 ACACATGCACACATGCACAATGG + Intergenic
978806138 4:112802517-112802539 GCACATCAACAGATACATCAAGG - Intergenic
981223718 4:142267364-142267386 ACACATTGACCGATGGAACAGGG + Intronic
985382666 4:189412052-189412074 ACACATACACACACACAACATGG + Intergenic
986969137 5:13311556-13311578 ACACTCCCACAGATGTAACCTGG + Intergenic
987042260 5:14074118-14074140 ACACATGCACACACACAACACGG + Intergenic
989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG + Exonic
989111317 5:37908937-37908959 ATACATTCACACATGCAATATGG + Intergenic
992931500 5:81652197-81652219 ACACAGCCACAGATGTACCCTGG - Intronic
998769473 5:145525494-145525516 TCGCCTCTACAGATGCAACAGGG + Intronic
1002540170 5:179901454-179901476 ACACATCCACACAGGCAGCGAGG - Intronic
1003002611 6:2350164-2350186 ACACGTCCCCTGAAGCAACATGG - Intergenic
1003990485 6:11481856-11481878 ACAAATACACAGAAGGAACATGG + Intergenic
1007212016 6:40200756-40200778 ACACATCGACTAATGGAACAGGG - Intergenic
1007904143 6:45442432-45442454 CCAAGTCCACAGATGGAACAAGG - Intronic
1009290269 6:61871545-61871567 ACACATCATCAGATTCACCAAGG + Intronic
1012626363 6:101408346-101408368 ACACATACACACATGCAGCAGGG + Intronic
1012764139 6:103342855-103342877 ATACATACACACATGCATCAGGG - Intergenic
1013815808 6:114095861-114095883 ACGTATCCAGAGATGTAACAGGG - Intronic
1014347197 6:120287388-120287410 ACAAATCCACAGAAGGAAAAGGG - Intergenic
1014935802 6:127383381-127383403 ACAAATCCACAGATCCAAGAAGG + Intergenic
1018951867 6:168384519-168384541 ACACACCCACTGAAACAACAGGG - Intergenic
1019267665 7:127458-127480 CAACATCCACAGATTCAGCAGGG - Intergenic
1021239238 7:18180149-18180171 ACACATCAAAAGATGAAGCAAGG - Intronic
1021534295 7:21685609-21685631 ACCCATCCACATATGGAAGAAGG - Intronic
1023979570 7:45060460-45060482 ACCCATCCACAGATCCAATAAGG - Intronic
1024108775 7:46122830-46122852 ACACATAGACAAATGGAACAAGG - Intergenic
1025259231 7:57406200-57406222 CCACATCCATAGATGCCACATGG - Intergenic
1025609623 7:63066961-63066983 CCACATCCATAGATGCCACATGG + Intergenic
1027552131 7:79612282-79612304 ACTGATCCACAGATGCAAGAGGG + Intergenic
1028143413 7:87296079-87296101 ACAAAGCCACACATGCCACATGG + Intergenic
1028966363 7:96806028-96806050 ACACATCCAAAGATCCCACTAGG + Intergenic
1029193324 7:98787023-98787045 ACACATCCCCACAGGCAACAAGG - Intergenic
1032207165 7:129877275-129877297 ACACCTACCCAGATACAACAGGG + Intronic
1032630418 7:133644966-133644988 ACACATACAAAGATGCAAAGGGG - Intronic
1034774114 7:153808174-153808196 ACACACACACAGTGGCAACAAGG - Intergenic
1035038790 7:155912640-155912662 ACAAAAACACAGATGAAACAAGG + Intergenic
1035951034 8:4021356-4021378 AAAAATCCCCAGATGCGACACGG - Intronic
1037482733 8:19319739-19319761 ACACATCCACAGAAGAAACGTGG - Intronic
1037804719 8:22052829-22052851 ACTCATCCACATGTGCTACATGG - Intronic
1037909455 8:22735023-22735045 ACACACACACAGCTGCAAGACGG - Intronic
1038207024 8:25476468-25476490 ACACATACAGAGATGCAGGAGGG - Intronic
1039271606 8:35887403-35887425 ACACATCCAGACAGGCTACATGG + Intergenic
1041921468 8:63186987-63187009 CCACAACCACAGCAGCAACAAGG + Exonic
1042475385 8:69243038-69243060 ACACTTCTACAGATAAAACATGG - Intergenic
1042816728 8:72886274-72886296 ACAAATCAACAGATTCTACAAGG - Intronic
1043967999 8:86500881-86500903 TCACATCCATTGCTGCAACATGG + Intronic
1046598308 8:116287443-116287465 ACACACACACACATGCACCATGG + Intergenic
1047785545 8:128150841-128150863 TCACAGCCACAGATGCAAAGGGG + Intergenic
1049063146 8:140291962-140291984 ACACAGCCCCAGATGCCACTTGG + Intronic
1051664748 9:19458129-19458151 CCACATCCACCTATTCAACATGG - Intergenic
1056645646 9:88409347-88409369 ACACACACACAGAGCCAACAAGG - Intronic
1056870054 9:90268832-90268854 CCACATCTACAGATGCCACGTGG - Intergenic
1058154671 9:101501989-101502011 ACACCTACACAGATAAAACAAGG + Intronic
1062038930 9:134395390-134395412 ACACATGCAGAGATGCCCCAAGG - Intronic
1188855064 X:35184199-35184221 ACACATACAAAGAGACAACAGGG + Intergenic
1194703089 X:97138828-97138850 ACACATACAGGGATGCAAAAAGG + Intronic
1195480672 X:105341114-105341136 AAACATCCACAAATGCTTCAGGG - Intronic
1196979854 X:121200261-121200283 ACACATACACATATACACCATGG - Intergenic
1197517089 X:127446329-127446351 ACACAGCAGCAGAAGCAACATGG + Intergenic
1197571704 X:128157675-128157697 ACACATACACACACACAACATGG - Intergenic
1198438335 X:136638422-136638444 TCACATTCACAGGTGCCACATGG + Intergenic
1198894258 X:141433909-141433931 ACAAATCTACAGATGTAACTGGG - Intergenic