ID: 989025965

View in Genome Browser
Species Human (GRCh38)
Location 5:37068831-37068853
Sequence CTCTTTCTGAAACAAGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989025960_989025965 -6 Left 989025960 5:37068814-37068836 CCATGCACCCCTTTCCACTCTTT No data
Right 989025965 5:37068831-37068853 CTCTTTCTGAAACAAGTCTCAGG No data
989025959_989025965 16 Left 989025959 5:37068792-37068814 CCAAATTTATTTGAGCTGTACTC No data
Right 989025965 5:37068831-37068853 CTCTTTCTGAAACAAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989025965 Original CRISPR CTCTTTCTGAAACAAGTCTC AGG Intergenic
No off target data available for this crispr