ID: 989033990

View in Genome Browser
Species Human (GRCh38)
Location 5:37150506-37150528
Sequence TGTGCGCGCGTGTGTGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2660
Summary {0: 2, 1: 4, 2: 37, 3: 552, 4: 2065}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989033990_989033997 21 Left 989033990 5:37150506-37150528 CCCCCAACACACACGCGCGCACA 0: 2
1: 4
2: 37
3: 552
4: 2065
Right 989033997 5:37150550-37150572 CTCTTCCTTAGTTTGGAAAATGG No data
989033990_989033994 14 Left 989033990 5:37150506-37150528 CCCCCAACACACACGCGCGCACA 0: 2
1: 4
2: 37
3: 552
4: 2065
Right 989033994 5:37150543-37150565 ACTCCTCCTCTTCCTTAGTTTGG 0: 1
1: 0
2: 0
3: 19
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989033990 Original CRISPR TGTGCGCGCGTGTGTGTTGG GGG (reversed) Intronic