ID: 989034194

View in Genome Browser
Species Human (GRCh38)
Location 5:37152413-37152435
Sequence GGTTAAATGAGACCATGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989034194 Original CRISPR GGTTAAATGAGACCATGGTT GGG (reversed) Intronic
902299881 1:15494153-15494175 GGTGAAATAAGATCATGATTAGG - Intronic
904398953 1:30243295-30243317 GATTAAAGGAGACAATGGGTGGG - Intergenic
905850647 1:41272110-41272132 GGCTAAATGAGACCCTTGTGAGG - Intergenic
905881156 1:41464657-41464679 GGTTAAATGAGGTCATAGGTGGG + Intergenic
908358662 1:63346575-63346597 GATTAAATGAGATCATATTTGGG - Intergenic
909330556 1:74404694-74404716 GGTAAAATGAGTCCATAGTCTGG - Intronic
909800324 1:79797859-79797881 GGTAAAATGAGTCCTTGGTAAGG - Intergenic
909800328 1:79797899-79797921 GGTAAAATGAGTCCTTGGTAAGG - Intergenic
912739743 1:112183005-112183027 GGTTAAATGACATCATGGTGGGG + Intergenic
916383438 1:164239442-164239464 GCTGAAAGCAGACCATGGTTAGG - Intergenic
919450316 1:197764587-197764609 GGTAAAATGAAACCAGGATTTGG + Intronic
919811947 1:201414370-201414392 GATTAAATGAGACCATGTAAGGG + Intronic
1064122489 10:12632101-12632123 AGTTGAATGAGACGTTGGTTAGG - Intronic
1067566880 10:47345957-47345979 GGCGACATGAGACCATGATTAGG - Intergenic
1068281773 10:54881177-54881199 GGTAAAAGGAGAACATAGTTCGG + Intronic
1069307050 10:66983539-66983561 GTTTAGATGTTACCATGGTTGGG - Intronic
1072973034 10:100033801-100033823 GGTTAAATTTTACCAAGGTTTGG + Intergenic
1073546956 10:104357538-104357560 AGTGAAAAGAGACCAGGGTTTGG + Intronic
1073836153 10:107445176-107445198 GGTTAAGTGAGTCCAGAGTTTGG - Intergenic
1074233999 10:111566455-111566477 GGTTAAATGAGGACAAGGGTGGG + Intergenic
1078469225 11:11573742-11573764 GGTTTATTGAGACCATGATGAGG - Intronic
1079117976 11:17652706-17652728 GGTCAAGTGAGATCATGGATGGG + Intergenic
1080096558 11:28415585-28415607 GGTTGAATGAGAGCATGGGTTGG - Intergenic
1081426462 11:42931428-42931450 GGTTAAATGAGGCCATGGACTGG + Intergenic
1082774084 11:57232628-57232650 GATTAAATGAGATAATGCTTGGG + Intergenic
1083482906 11:62961135-62961157 GGTTAAATGAGGTCATGGGGTGG + Intronic
1084461705 11:69299859-69299881 GGTGAAATGAGACCCTGGATAGG - Intronic
1087156601 11:94910487-94910509 GGTTAAATGACATCATGTCTGGG - Intergenic
1092979573 12:13780455-13780477 GTTGAAATGAAGCCATGGTTGGG - Intronic
1094500546 12:31017153-31017175 GGTTATATGAGGCCATGGGGTGG + Intergenic
1096124187 12:49107622-49107644 GATTAAATGAGACTCTGGTTTGG - Intronic
1097578419 12:61423526-61423548 GGTTAAATGAGAACCTTTTTTGG - Intergenic
1098741295 12:74176854-74176876 GGTTAAATGAGGCCATAGGGTGG + Intergenic
1102914535 12:116743107-116743129 GGTTAAATGAAGCAGTGGTTGGG + Intronic
1105276929 13:18938970-18938992 GGTTAAATAAGATAATGTTTGGG + Intergenic
1105825401 13:24118244-24118266 GGTAAAAAGAGACCATGATGGGG - Intronic
1106046597 13:26147652-26147674 TCTTAAATGAGAACATGGATTGG - Intronic
1110736832 13:78947040-78947062 GGTTAAATGGAACCAGGGTGCGG - Intergenic
1110847049 13:80201943-80201965 GGTGAAATGAGAGCATGATGTGG - Intergenic
1111161795 13:84404651-84404673 GTTTAAATGAGGCCATAATTTGG + Intergenic
1114838705 14:26235729-26235751 GATTAAATGAGATCATGTTTGGG + Intergenic
1115494694 14:33991642-33991664 GGTGAAAGGAGAACAAGGTTTGG + Intronic
1117886888 14:60372999-60373021 GGTTTAATCAGCTCATGGTTTGG - Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1119985516 14:79132843-79132865 GGTTAGCTGAGCCCATTGTTGGG - Intronic
1120110277 14:80546216-80546238 GGTCAAATGAGACAATGGATGGG - Intronic
1123022744 14:105409362-105409384 GCTTGAATGACACCTTGGTTGGG + Intronic
1123916520 15:25034880-25034902 TGTTAAACTAGACCATGGATTGG + Intergenic
1126231146 15:46326622-46326644 GTTTTAATGAAACCATGGTTAGG + Intergenic
1128678668 15:69630258-69630280 GGCCAAATGAGATCGTGGTTAGG - Intergenic
1133111729 16:3551880-3551902 GGTTAAATGAGTATATGGGTGGG - Intronic
1133286068 16:4691472-4691494 GGTTAAATGAGACCTTGTACGGG - Intergenic
1133649995 16:7803537-7803559 GGTTATATTAGACCAAGGGTAGG + Intergenic
1133796021 16:9047103-9047125 TGTTAACTGACATCATGGTTGGG - Intergenic
1135121950 16:19773767-19773789 TTTTACATGAGACCATGGTTTGG - Intronic
1136072604 16:27797025-27797047 GATTAAATGAGTCCATGGACAGG - Intronic
1138384924 16:56629719-56629741 GATTAAATGACAGCATGGTCTGG + Intergenic
1139156490 16:64449240-64449262 GATTAAATGAGACACTGGGTGGG + Intergenic
1142357624 16:89609926-89609948 GGTTAAAAAAAACCATGGGTTGG - Intergenic
1148319739 17:46740287-46740309 GGTTAAATGAGGGCAGGGTATGG + Intronic
1152877669 17:82796389-82796411 AGTTAAATGAGAACTTGTTTTGG + Intronic
1157789036 18:50514306-50514328 AGTTAAATGAAAGCTTGGTTTGG + Intergenic
1158964301 18:62610005-62610027 GATCAAATGACATCATGGTTGGG - Intergenic
1160047454 18:75400213-75400235 GGTTGGATGAGACCATTGTGAGG + Intergenic
1160179407 18:76620709-76620731 GGTTAAATGAGTCCATTTTCTGG - Intergenic
1161657577 19:5525450-5525472 GGATAAATGAGTAGATGGTTAGG - Intergenic
1161657606 19:5525569-5525591 GGATAAATGAGTAGATGGTTAGG - Intergenic
1165779080 19:38421867-38421889 GGTAAAATGAGAACAGGGCTGGG - Intronic
1167119876 19:47510492-47510514 GGATAAATGAGACGATGTGTGGG - Intronic
927798682 2:26076141-26076163 GATTAAATGAGATCATGTGTAGG - Intronic
928743731 2:34387056-34387078 GGTAAAATTAGGCCTTGGTTTGG + Intergenic
932851593 2:75192805-75192827 GATTAAATGAGACAATGGACTGG + Intronic
932958612 2:76385960-76385982 GGTTTAATGAAACCATGATTAGG + Intergenic
933426287 2:82115903-82115925 GGATAGCTGAGACCATGCTTAGG + Intergenic
941650915 2:168091836-168091858 GGTAAAATGATACCATGTTTGGG - Intronic
943193565 2:184713409-184713431 GGTGAAATTAAACCGTGGTTTGG - Intronic
944463251 2:199974469-199974491 GGTTGAGTGAGACCATGTTCTGG - Intronic
944706626 2:202295772-202295794 TGATAAATGAGACCATACTTAGG - Exonic
1169022194 20:2338814-2338836 GGTCAAATGAGATCAAGGATGGG - Intronic
1170288471 20:14739466-14739488 GGATAAATAAGACCATGGACGGG + Intronic
1174861105 20:54091990-54092012 GATTAAATGAGACAATGTTATGG - Intergenic
1174965809 20:55213513-55213535 AGTTAAATGAGATGATCGTTTGG + Intergenic
1175539835 20:59741413-59741435 GGTTAAATCGGAGCCTGGTTGGG + Intronic
1177089224 21:16745761-16745783 GGTTAAATCTGACCAGGGCTAGG - Intergenic
1177234908 21:18375947-18375969 AGTAAATTGAAACCATGGTTTGG + Intronic
1177277835 21:18938292-18938314 GGTTTTATGAGAACATAGTTTGG - Intergenic
1177734320 21:25070026-25070048 GGTTAAATGAGGCCATAATGGGG + Intergenic
1182558026 22:31139647-31139669 GCTTAAATGAGGTCACGGTTGGG - Intronic
1183378063 22:37476578-37476600 GGTTAAATGAGAAAATGTCTGGG - Intronic
1184878063 22:47288102-47288124 GTTGAACTGAGACCCTGGTTAGG - Intergenic
1184946315 22:47806843-47806865 GGTTGAATTAGTCCATGGATAGG - Intergenic
949716162 3:6933963-6933985 AGTTAAATGAGGACAAGGTTGGG + Intronic
950672466 3:14535529-14535551 GATTAAATGAGATCGTGCTTAGG - Intronic
951459500 3:22934726-22934748 GGCTCAATGTGAGCATGGTTAGG - Intergenic
952756291 3:36870837-36870859 AGTTAAATGTGACCTGGGTTTGG - Intronic
952969750 3:38643424-38643446 GGAAAAATCAGACCATGGGTGGG - Intronic
953326814 3:42018525-42018547 TGTTAAATAAGACCATGCTGTGG + Intronic
956373656 3:68590968-68590990 GCTTAAAGGAGACAATAGTTTGG + Intergenic
956898260 3:73685923-73685945 GGGTAAATGTGACCATGACTCGG + Intergenic
958699725 3:97572544-97572566 GGTAATATGAGCCCTTGGTTTGG + Intronic
961524788 3:127489803-127489825 GGTGAAATGAGAGCATGGGGTGG + Intergenic
961559623 3:127719494-127719516 AGTTAAATGAGACAATGCCTGGG + Intronic
963289814 3:143476031-143476053 TGTTAAATCAAACCCTGGTTTGG + Intronic
963571557 3:147003705-147003727 GGTTTAATCAGTTCATGGTTTGG + Intergenic
965440611 3:168708768-168708790 ATTAAAATGAAACCATGGTTTGG - Intergenic
971867614 4:32192412-32192434 GGTTAAATGAGGTCATGGTGTGG + Intergenic
974875361 4:67697753-67697775 GGTGAAATGTGATGATGGTTTGG - Intronic
977442256 4:97083056-97083078 GGTTAAATGAAACCAAGAATTGG - Intergenic
978351351 4:107824251-107824273 GGACAAATGACACGATGGTTAGG + Intergenic
978444252 4:108765381-108765403 GCTTGAATGAGATCATGATTTGG + Intergenic
980603739 4:135061738-135061760 GGTTAAATGAGGTCATAGATTGG + Intergenic
982864124 4:160488958-160488980 GGTCAAATGTGCCCCTGGTTCGG - Intergenic
983095122 4:163552395-163552417 AGTTAACTGAGACCCAGGTTTGG + Intronic
983311428 4:166066954-166066976 GTTTAAATGATCCCATGGTTAGG + Intronic
984858731 4:184218234-184218256 GTTTAAATGAGGCCATGATGTGG - Intronic
985476371 5:81554-81576 GGTAAAAGGAGGCCCTGGTTGGG - Intergenic
986242453 5:5973155-5973177 AGTCAAATGACACCATGATTGGG + Intergenic
988266791 5:28962152-28962174 CATTAAATGAGGCCATGGTGAGG + Intergenic
989034194 5:37152413-37152435 GGTTAAATGAGACCATGGTTGGG - Intronic
990616344 5:57512311-57512333 GGCTAAATGAGATCATGTATGGG - Intergenic
991726575 5:69541585-69541607 TGCTAAATGAGACCATTGTTTGG + Intronic
991868382 5:71086289-71086311 TGCTAAATGAGACCATTGTTTGG - Intergenic
995803748 5:116028280-116028302 GGTGGACTGAGAGCATGGTTGGG - Intronic
1000662741 5:163956296-163956318 GGTTAAATGAGGTCATGGGGTGG + Intergenic
1000939272 5:167340566-167340588 GGTTAAATGAGATCATGAGAGGG - Intronic
1009344612 6:62597771-62597793 ACTTAAGTGAGACCATGGTCAGG - Intergenic
1016880637 6:148908134-148908156 GCTAAAATGAGACCCTGGTCAGG - Intronic
1018462154 6:164008624-164008646 GCTTAAAGAAGACCATGCTTAGG - Intergenic
1020003021 7:4766300-4766322 GGTGAAATGAGACGCTGGTGTGG + Exonic
1022189053 7:27999218-27999240 GATTAAATGGGACCAAGTTTTGG - Intronic
1023476462 7:40584570-40584592 GGTCAAATGAGATAATGGCTGGG - Intronic
1023916106 7:44590541-44590563 GTTTAAAAGAGACCAAGGCTGGG + Intergenic
1025598809 7:62968301-62968323 AGTTAAATGAGAAACTGGTTTGG + Intergenic
1028541544 7:91947728-91947750 GGATAAATGAAATAATGGTTGGG + Intronic
1030961054 7:115923549-115923571 AATTAAATGAAACAATGGTTTGG - Intergenic
1037733346 8:21547834-21547856 GGATAAGTGAGACTGTGGTTCGG + Intergenic
1039106118 8:33991701-33991723 AATCAAATGAGATCATGGTTTGG - Intergenic
1041567061 8:59290633-59290655 GGTTAAATGAGGTCATGGGATGG - Intergenic
1042048732 8:64684164-64684186 TGTTAAATGAATGCATGGTTGGG + Intronic
1045725499 8:105168531-105168553 GGTTAAATGAGACAATGGGCTGG + Intronic
1048643250 8:136388086-136388108 GGTTAAATGAGATCATAGGGTGG + Intergenic
1048854226 8:138673044-138673066 GGATGAATGAGGCCATTGTTTGG - Intronic
1049192246 8:141294856-141294878 GGTTAGATGAGGCCTAGGTTTGG - Intronic
1049624705 8:143614781-143614803 CGATAGATGAGACCATGGTGAGG - Exonic
1049840846 8:144770672-144770694 GGTTAAATGAGGCCATAGGGTGG + Intergenic
1057456948 9:95222467-95222489 GGCTAACTGAGACCAGAGTTGGG + Intronic
1058795090 9:108490291-108490313 GGTCAAATGAGAACTTGCTTTGG + Intergenic
1058946290 9:109859761-109859783 GGTTAAATGGGTACATGGCTAGG + Intronic
1059953836 9:119495579-119495601 GCTTAAATAAGAACAGGGTTTGG + Intronic
1187610815 X:20940787-20940809 GCTTAAATGTCATCATGGTTTGG + Intergenic
1188866369 X:35318031-35318053 GGTTGAATGAGACTTTGGTAAGG + Intergenic
1189005271 X:36987531-36987553 TGTTAAATGTCACCATGATTGGG + Intergenic
1189043756 X:37570411-37570433 TGTTAAATGTCACCATGATTGGG - Intronic
1197459423 X:126722354-126722376 GGTAAAATATGACCATGGCTTGG - Intergenic
1198011860 X:132564676-132564698 GGTTAGATAAGACCTTAGTTTGG + Intergenic
1198666122 X:139025160-139025182 TGTAAAATTAGACCAGGGTTTGG - Intronic