ID: 989035781

View in Genome Browser
Species Human (GRCh38)
Location 5:37170184-37170206
Sequence CAACATCACCACATCCTCTT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989035780_989035781 1 Left 989035780 5:37170160-37170182 CCTTAAGATTTTTGTTGCTGTCT 0: 1
1: 0
2: 0
3: 31
4: 370
Right 989035781 5:37170184-37170206 CAACATCACCACATCCTCTTAGG 0: 1
1: 0
2: 2
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989035781 Original CRISPR CAACATCACCACATCCTCTT AGG Exonic
905293713 1:36940971-36940993 AAACATCATCACATTTTCTTGGG - Intronic
905926176 1:41751510-41751532 CCTCCTCACCACATCCTCCTGGG - Intronic
907946110 1:59138025-59138047 CACCATCCCCACCTCCTCCTTGG + Intergenic
908004373 1:59712755-59712777 CAACATCACTTTTTCCTCTTAGG + Intronic
911252319 1:95591104-95591126 CAACATAACCACAGACACTTGGG - Intergenic
912484964 1:110019370-110019392 CAAAAACAACAAATCCTCTTAGG + Intronic
914775687 1:150732682-150732704 CAACATAGCCTCAACCTCTTGGG + Exonic
915203207 1:154249373-154249395 AAGCACCACCACCTCCTCTTGGG + Exonic
920916801 1:210264282-210264304 CAACATCACCACTGACACTTTGG - Intergenic
921962005 1:221045966-221045988 CAACCTCACCACTTCCTATTTGG - Intergenic
923405878 1:233659639-233659661 CAGCATCACCACAGACACTTGGG + Intronic
924171587 1:241347639-241347661 CAACATCAGCAAATCATCTGAGG + Intronic
1065284221 10:24171952-24171974 CATCCTCACAACATCCTCTGAGG + Intronic
1068411337 10:56659991-56660013 CACCACCACCACACCCTCATAGG + Intergenic
1069163647 10:65121263-65121285 CAACATCTTCTCATCCTATTTGG + Intergenic
1070759934 10:79017755-79017777 CAACATCTCCCCATACTCCTAGG - Intergenic
1072631658 10:97150911-97150933 CAACATCTCCACATCCTCTGAGG + Intronic
1074745913 10:116532164-116532186 CAACATCATCAACTCCACTTAGG - Intergenic
1075777917 10:124999961-124999983 CAACAGCAGCACCTCCTCCTAGG + Intronic
1076433539 10:130424202-130424224 CAACATCATCACCTGCTCTAGGG - Intergenic
1078855626 11:15204553-15204575 CAACCTCACCAGAGCCTCTGTGG - Intronic
1087219856 11:95535115-95535137 CATCACCACAAAATCCTCTTGGG - Intergenic
1088227276 11:107635048-107635070 TAACAACACCACCTCCACTTAGG - Intronic
1089395721 11:118135561-118135583 CAACATCACCACCTCCCCCTAGG + Exonic
1090501705 11:127267286-127267308 CAACAACACCACAACCCCTCTGG + Intergenic
1090659931 11:128874663-128874685 CTTCATCACCACAGCCTCATGGG + Intergenic
1091204002 11:133806572-133806594 CAACATCAGAACAACCACTTTGG + Intergenic
1093490087 12:19696034-19696056 CCACATCACAGCATCCACTTTGG + Intronic
1095123797 12:38450467-38450489 TAACATCAACACATTTTCTTGGG - Intergenic
1097189084 12:57210930-57210952 GAACATCACCCCATGCTCTGGGG - Intronic
1098762363 12:74440823-74440845 CAACATCACTTCATGCTCATAGG + Intergenic
1098916691 12:76264231-76264253 TAACATCACCAGATCATCTGTGG + Intergenic
1100623548 12:96305792-96305814 CACCACAACCTCATCCTCTTGGG + Intronic
1102083098 12:110114285-110114307 CAAGACCACCTCATCCTCCTGGG - Intergenic
1103481019 12:121249684-121249706 CCACAGCACCACACCCTCCTTGG - Intronic
1106424523 13:29613074-29613096 CAACATTCCAACATCTTCTTGGG + Intergenic
1107218346 13:37949139-37949161 CCACATCTCCACAACCTCTCTGG + Intergenic
1108580516 13:51824549-51824571 TAAAATCACCACATCCACTGCGG - Intergenic
1110574982 13:77045310-77045332 AAACTTCACCGCATCCTCTTGGG + Exonic
1113041500 13:106108011-106108033 AGACATCCCCACATTCTCTTAGG - Intergenic
1115438325 14:33402553-33402575 GAACATCTCCTCATCCTCTGTGG + Intronic
1119386386 14:74260264-74260286 GAACAGCACCAGCTCCTCTTGGG + Intronic
1119899359 14:78246812-78246834 CCACTTCACCACATTATCTTTGG - Intronic
1121441329 14:93951532-93951554 TAACATCACTACATCCTTTAAGG - Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1127185710 15:56478219-56478241 CAACAACAACAAATCCTCCTGGG - Intergenic
1128439623 15:67693003-67693025 CAACATCACAGCATGCTCATGGG - Intronic
1129965553 15:79731983-79732005 CATCATCACCACATACTGTGTGG - Intergenic
1130830874 15:87597527-87597549 CCCCAACACCACATCCTCATGGG - Intergenic
1134840701 16:17399338-17399360 CAACAGCACCAGAACCTCTGGGG - Intronic
1135652591 16:24219021-24219043 CATCATCACCACACCCACCTGGG - Exonic
1135655987 16:24250004-24250026 CAAGACTACCACATCCTCGTTGG - Intergenic
1136180498 16:28548600-28548622 CAGCATCAGTCCATCCTCTTAGG + Intergenic
1137383632 16:48021792-48021814 CAACAACGGCACCTCCTCTTGGG - Intergenic
1138209292 16:55149630-55149652 AGAAATCACCACATGCTCTTTGG - Intergenic
1138949686 16:61896994-61897016 AAACTTCAACACATCCTCTGTGG + Intronic
1139066775 16:63325399-63325421 CAACTTCCCCTCCTCCTCTTAGG - Intergenic
1139951932 16:70676817-70676839 GAACATCCCCACTTCCTCTTGGG + Intronic
1140850845 16:78933361-78933383 CAACATAACCTCAGCCTCCTGGG - Intronic
1142045910 16:87925157-87925179 CCACAGCTCCACATCCTCTCCGG - Intronic
1142524395 17:529029-529051 TAATTTCACCAAATCCTCTTTGG + Intronic
1143148116 17:4789623-4789645 CGACAGCCCCACATCCCCTTCGG - Exonic
1144435600 17:15237299-15237321 CAACATCATTACATCATTTTAGG - Intronic
1146466771 17:33092423-33092445 CAACTTCACACCATCCACTTTGG + Intronic
1153445777 18:5171076-5171098 CAACATGACCCCATTCTTTTGGG - Intronic
1156498233 18:37540210-37540232 CAACCTCTCCACATCCTCCTGGG - Intronic
1158338827 18:56443691-56443713 GGACATCACCACATCCTATGGGG + Intergenic
1160093268 18:75846725-75846747 CACCACCACCACCTCCTTTTTGG - Intergenic
1162824243 19:13241864-13241886 CCACATCACCCCAGCCACTTGGG + Intronic
1163865290 19:19768762-19768784 GAACTTCACCTCATCCACTTTGG - Intergenic
1164559063 19:29276115-29276137 CCACTCCACCCCATCCTCTTTGG + Intergenic
1168605321 19:57754475-57754497 CAACATCAGCAGATCCACTCTGG + Exonic
926636486 2:15185305-15185327 CACCATTACCACCTCCTGTTAGG + Intronic
926681617 2:15668324-15668346 CAACATCCCCCAATCCTATTAGG - Intergenic
929176663 2:38985117-38985139 CAACACCACCACATTTTGTTTGG + Exonic
929919813 2:46163984-46164006 CCACCTCACCACAACCTCTGTGG - Intronic
930004687 2:46887141-46887163 CAACCTAACCAGATCCTCTGAGG + Intergenic
932820811 2:74898365-74898387 CAATATGACCACATCTTCCTTGG + Intergenic
933351586 2:81159400-81159422 CAACATCACCAGAACTTGTTAGG + Intergenic
936676841 2:114725519-114725541 CAATAGCTCCACATCTTCTTTGG + Intronic
937035880 2:118781491-118781513 CAGCATCACCCCTTCATCTTTGG + Intergenic
938609256 2:132930255-132930277 CATCATCACTATAGCCTCTTGGG - Intronic
939021054 2:136958957-136958979 CACCATTACCACACCCTCTGAGG - Intronic
941046804 2:160685326-160685348 CAATATCACCGCAACTTCTTGGG - Intergenic
941562637 2:167067663-167067685 CAAAGTGACCACATGCTCTTGGG + Intronic
943824399 2:192370855-192370877 AAACATCACCCCATCATCTCTGG + Intergenic
943898373 2:193399181-193399203 CAATATAACTACATCATCTTAGG + Intergenic
944425345 2:199576400-199576422 CAACAGCAACACAACCCCTTAGG + Intergenic
945247955 2:207737627-207737649 CAACATAAACAAATACTCTTTGG - Intronic
945830520 2:214779136-214779158 CAACATGACCACATATCCTTTGG - Intronic
945971307 2:216234327-216234349 CTGCATCTCCACATCCTCTCTGG - Intergenic
1169063809 20:2681197-2681219 CAACATCCCCAAATCCTCTCTGG - Intergenic
1173960921 20:47071949-47071971 CAGCATCACCACGGCCTCCTGGG - Intronic
1175720781 20:61285828-61285850 CAACATCACCAGAACCACGTGGG - Intronic
1175955611 20:62607688-62607710 CAAGAACACCTCCTCCTCTTGGG + Intergenic
1176756377 21:10728712-10728734 CCACCTCACCACATTCTATTTGG + Intergenic
1178680943 21:34671015-34671037 CCACAACCCCACATCCTCATTGG - Intronic
1179613119 21:42565088-42565110 CAACACCTCCCCAACCTCTTAGG + Intronic
1180128770 21:45811191-45811213 CAACATCACCACAGACTCCATGG + Intronic
1181881412 22:25983219-25983241 GCACATCACCACATCCACTTAGG - Intronic
1182841168 22:33391153-33391175 CAATATCCTCACATCCTCATAGG + Intronic
1184856258 22:47148434-47148456 CAAGATCACCAAACTCTCTTAGG - Intronic
950268435 3:11593251-11593273 CAACATGATCATACCCTCTTTGG - Intronic
953271109 3:41446233-41446255 CTATTTCTCCACATCCTCTTCGG - Intronic
954392216 3:50273753-50273775 CAACAGAAACACATCCTCTGCGG - Exonic
954818550 3:53304041-53304063 CAACATAATGACATCCTCCTAGG - Intronic
955606357 3:60709095-60709117 CAACATAACCACAAACTCTTTGG - Intronic
955871549 3:63443645-63443667 CAGTATCAACACAGCCTCTTTGG - Intronic
958025523 3:88044151-88044173 AAACATCACAAATTCCTCTTTGG + Intergenic
960329477 3:116340865-116340887 CTACATAACCACATCCAGTTGGG + Intronic
962199389 3:133389027-133389049 CATCATCACCAGAGCCTCTGGGG - Intronic
963396779 3:144744668-144744690 CATAACCACCACTTCCTCTTCGG + Intergenic
964367044 3:155961530-155961552 CCATTTCTCCACATCCTCTTCGG + Intergenic
964872272 3:161326097-161326119 CACCATCCCCACTTCCACTTTGG - Intergenic
967775803 3:193384582-193384604 CAACACCACCACATTTTGTTTGG - Intergenic
969900697 4:10346485-10346507 CAACATAAGCACAGTCTCTTTGG + Intergenic
970831865 4:20349060-20349082 CAACATCTTCACTTTCTCTTTGG - Intronic
971968311 4:33591633-33591655 CAACACCACCACTTCATTTTGGG + Intergenic
972123273 4:35732235-35732257 CCACACCACCACCTCTTCTTGGG + Intergenic
973530819 4:51835511-51835533 CACCATCACCACAACCTCAGTGG - Intergenic
974703433 4:65481611-65481633 CAAAATCCCAACATCCTCTTGGG + Intronic
974866833 4:67591527-67591549 CCACATCACCACATTCTCATTGG - Intronic
976777483 4:88722007-88722029 GAACATCATCCCATTCTCTTGGG - Intergenic
977247786 4:94654191-94654213 AAACATCACCAAATTCCCTTAGG + Intronic
977632443 4:99258089-99258111 CTATTTCTCCACATCCTCTTTGG + Intergenic
978406887 4:108389727-108389749 CAATTACTCCACATCCTCTTTGG - Intergenic
978496621 4:109366367-109366389 CAATATCCCCAAATCCTCCTTGG + Intergenic
981532797 4:145768575-145768597 CAACATGACCCCATCGTTTTAGG + Intronic
981852363 4:149246007-149246029 AAACATCACCAGGTCTTCTTGGG + Intergenic
982767281 4:159363467-159363489 CAACCTTAGCACATTCTCTTTGG + Intergenic
984913732 4:184700764-184700786 CACCATCATTACATCCTTTTAGG + Intronic
986172331 5:5324971-5324993 CAACATCACAACATCCAACTGGG + Intergenic
989000311 5:36752963-36752985 AAACTTCATCAAATCCTCTTGGG + Intergenic
989035781 5:37170184-37170206 CAACATCACCACATCCTCTTAGG + Exonic
989250494 5:39308930-39308952 CAACATCTCCTGATCCTCTTTGG + Intronic
992641305 5:78770664-78770686 CCAGTTCACCACAGCCTCTTTGG - Intergenic
993354075 5:86884423-86884445 GAACTTCACCTCATCCACTTTGG + Intergenic
996211038 5:120810522-120810544 CAACAACACAATATACTCTTTGG + Intergenic
996468851 5:123835830-123835852 CAAAATCACTACATACTTTTAGG - Intergenic
996682098 5:126238694-126238716 CAAGATCAGCCCCTCCTCTTTGG + Intergenic
997721460 5:136081043-136081065 CATCATCAGCAAATCCTCTTTGG + Intergenic
998879305 5:146630500-146630522 CAACTTCATCACTTGCTCTTTGG + Intronic
1001487339 5:172128975-172128997 ACGCATCACCACATCCTCATAGG - Intronic
1007048874 6:38805400-38805422 CTACATGGCCAAATCCTCTTAGG - Intronic
1008786240 6:55172304-55172326 CATCATCACCTCATCCTGTTTGG + Intronic
1009751183 6:67881079-67881101 CAACCCCACCACTTCCTTTTCGG - Intergenic
1010290527 6:74131602-74131624 CAAAATCACTATATCTTCTTGGG + Intergenic
1011606078 6:89107155-89107177 GAACATAAGCAAATCCTCTTGGG + Exonic
1012106672 6:95170029-95170051 CAATATCAGCAGGTCCTCTTGGG + Intergenic
1013539791 6:111096893-111096915 CACCATAACCTCAACCTCTTGGG + Intronic
1013964704 6:115940848-115940870 CTATTTCTCCACATCCTCTTTGG - Exonic
1015872437 6:137790719-137790741 CAGCAGCCCCACATCCTCTCAGG - Intergenic
1016374223 6:143404087-143404109 AAATATCACCTCATCATCTTTGG - Intergenic
1016401573 6:143687127-143687149 CAACATCACCTACTTCTCTTTGG + Intronic
1017727718 6:157287238-157287260 CAAGACCACCACCTCCTCCTCGG + Intergenic
1017818265 6:158030522-158030544 CCCCACCCCCACATCCTCTTTGG + Intronic
1017840924 6:158222354-158222376 CCACATCCCCACATCCTGATTGG - Intergenic
1017978094 6:159375437-159375459 GAACATCACCACACCCCCTGGGG - Intergenic
1019311605 7:364532-364554 CAACAGCTTCAGATCCTCTTAGG + Intergenic
1023391214 7:39713464-39713486 CAACATCAGCTCAGCTTCTTGGG - Intergenic
1024460678 7:49656259-49656281 CATCATTACCCCAGCCTCTTTGG - Intergenic
1031393111 7:121240582-121240604 ATACAGCCCCACATCCTCTTTGG - Intronic
1035221832 7:157410783-157410805 TAACCTCACGACATCCGCTTCGG - Intronic
1035342552 7:158173218-158173240 CACCATCATCACTTCCTATTGGG + Intronic
1035840702 8:2809723-2809745 TAGCATCTCCACATCCTCTTTGG + Intergenic
1038854284 8:31314184-31314206 CCAGATCCCCACATTCTCTTGGG - Intergenic
1039224599 8:35374278-35374300 TAACATCACATCATCATCTTTGG - Intronic
1039547048 8:38417874-38417896 CAACATCTTCACAGCCACTTTGG + Exonic
1040411339 8:47157554-47157576 CGACTTCACCTCATCCACTTTGG - Intergenic
1040734846 8:50492373-50492395 CTACTTCTCCACATCCTCTCCGG + Intronic
1042385770 8:68172582-68172604 AAACATCACCACATCCCCAATGG - Intronic
1042482833 8:69323355-69323377 GAACAACACCAGCTCCTCTTTGG - Intergenic
1045351722 8:101347211-101347233 TAAAATCACCACCTCCTCTATGG + Intergenic
1047305778 8:123652058-123652080 CAAGATTTCCTCATCCTCTTGGG - Exonic
1048195108 8:132326123-132326145 CACCTTCACCACATTGTCTTTGG - Intronic
1050875674 9:10632530-10632552 CAATATCACCACACTATCTTTGG - Intergenic
1052085419 9:24259643-24259665 CAATATAACCACTGCCTCTTAGG + Intergenic
1052262896 9:26538612-26538634 CACCATCACATTATCCTCTTAGG + Intergenic
1055197130 9:73609783-73609805 TAACATCACCCCATCCCCATTGG - Intergenic
1057329671 9:94101681-94101703 CAACATGTCCACATCCTCTTTGG - Exonic
1058448066 9:105071185-105071207 CAGCATCAAATCATCCTCTTAGG - Intergenic
1059919267 9:119139446-119139468 CAACATCATTACATCATTTTAGG - Intergenic
1062004879 9:134234091-134234113 CAACATCAGCACAGCCTGTTGGG + Intergenic
1203345754 Un_KI270442v1:33006-33028 CAACTTCACCACATTCCATTCGG - Intergenic
1186457320 X:9720099-9720121 CAAAGTCACCCCATCCTGTTAGG - Intergenic
1187914602 X:24141687-24141709 CAATAAAACCACATCTTCTTGGG - Intergenic
1189534831 X:41924752-41924774 CCACATCACCCCCTCCACTTTGG - Intergenic
1191588163 X:62851415-62851437 CACCACCACCACCTCCTTTTTGG + Intergenic
1194056138 X:89134401-89134423 CTATTTCACCACATCCTCTCCGG + Intergenic
1201453153 Y:14138025-14138047 CAAAATTTCCACATCATCTTGGG + Intergenic