ID: 989038429

View in Genome Browser
Species Human (GRCh38)
Location 5:37199889-37199911
Sequence ACTCTTAGTGAGACTGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989038429_989038434 8 Left 989038429 5:37199889-37199911 CCCAAGCCAGTCTCACTAAGAGT 0: 1
1: 0
2: 0
3: 7
4: 188
Right 989038434 5:37199920-37199942 ATCCTCTTGCTTGGAATGCTGGG 0: 1
1: 0
2: 0
3: 22
4: 134
989038429_989038432 -1 Left 989038429 5:37199889-37199911 CCCAAGCCAGTCTCACTAAGAGT 0: 1
1: 0
2: 0
3: 7
4: 188
Right 989038432 5:37199911-37199933 TGAATCTCAATCCTCTTGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 157
989038429_989038433 7 Left 989038429 5:37199889-37199911 CCCAAGCCAGTCTCACTAAGAGT 0: 1
1: 0
2: 0
3: 7
4: 188
Right 989038433 5:37199919-37199941 AATCCTCTTGCTTGGAATGCTGG 0: 1
1: 0
2: 1
3: 4
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989038429 Original CRISPR ACTCTTAGTGAGACTGGCTT GGG (reversed) Intronic