ID: 989038430

View in Genome Browser
Species Human (GRCh38)
Location 5:37199890-37199912
Sequence CACTCTTAGTGAGACTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989038430_989038432 -2 Left 989038430 5:37199890-37199912 CCAAGCCAGTCTCACTAAGAGTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 989038432 5:37199911-37199933 TGAATCTCAATCCTCTTGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 157
989038430_989038434 7 Left 989038430 5:37199890-37199912 CCAAGCCAGTCTCACTAAGAGTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 989038434 5:37199920-37199942 ATCCTCTTGCTTGGAATGCTGGG 0: 1
1: 0
2: 0
3: 22
4: 134
989038430_989038433 6 Left 989038430 5:37199890-37199912 CCAAGCCAGTCTCACTAAGAGTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 989038433 5:37199919-37199941 AATCCTCTTGCTTGGAATGCTGG 0: 1
1: 0
2: 1
3: 4
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989038430 Original CRISPR CACTCTTAGTGAGACTGGCT TGG (reversed) Intronic