ID: 989038433

View in Genome Browser
Species Human (GRCh38)
Location 5:37199919-37199941
Sequence AATCCTCTTGCTTGGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989038429_989038433 7 Left 989038429 5:37199889-37199911 CCCAAGCCAGTCTCACTAAGAGT 0: 1
1: 0
2: 0
3: 7
4: 188
Right 989038433 5:37199919-37199941 AATCCTCTTGCTTGGAATGCTGG 0: 1
1: 0
2: 1
3: 4
4: 147
989038431_989038433 1 Left 989038431 5:37199895-37199917 CCAGTCTCACTAAGAGTGAATCT 0: 1
1: 0
2: 1
3: 15
4: 214
Right 989038433 5:37199919-37199941 AATCCTCTTGCTTGGAATGCTGG 0: 1
1: 0
2: 1
3: 4
4: 147
989038430_989038433 6 Left 989038430 5:37199890-37199912 CCAAGCCAGTCTCACTAAGAGTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 989038433 5:37199919-37199941 AATCCTCTTGCTTGGAATGCTGG 0: 1
1: 0
2: 1
3: 4
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989038433 Original CRISPR AATCCTCTTGCTTGGAATGC TGG Intronic