ID: 989038753

View in Genome Browser
Species Human (GRCh38)
Location 5:37204330-37204352
Sequence GTAAAACCAGGGCAACTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989038753 Original CRISPR GTAAAACCAGGGCAACTGTG AGG (reversed) Intronic
902404984 1:16177611-16177633 GTAAAGTCAGGGTAAGTGTGCGG + Intergenic
902990725 1:20185724-20185746 TTAAAACCAGGGACACTGAGAGG + Intergenic
903277161 1:22229451-22229473 GCAAGGCCAGGGAAACTGTGAGG + Intergenic
905281501 1:36852365-36852387 CTGCAACCAGGGCAATTGTGTGG + Intronic
905974761 1:42166077-42166099 GGAAATCCAGTGCAGCTGTGAGG - Intergenic
906793618 1:48679438-48679460 GTACAACCAGGGCCACAGTGGGG + Intronic
910096221 1:83525231-83525253 GTATAACCAGGTCTACTGTTTGG - Intergenic
912324090 1:108741351-108741373 GTACATCCTGGGCAACTTTGAGG + Intronic
914855087 1:151344882-151344904 GAAGAACCAGGACAACTGTTAGG - Intronic
915089688 1:153415780-153415802 CTAAATCCAGGGCTTCTGTGAGG + Intergenic
916461894 1:165033886-165033908 TTAAATCCAGGATAACTGTGTGG - Intergenic
916998340 1:170326617-170326639 GTCAAACCAGGCAAAGTGTGTGG - Intergenic
921171556 1:212554468-212554490 AAAAAACCAGAGCAACTGTTAGG + Intergenic
924541122 1:244981736-244981758 GTAAAACCGGAGGAAGTGTGAGG - Intronic
1063286102 10:4690392-4690414 GGAAAATCAGGCCAACTGTCAGG - Intergenic
1068431626 10:56940591-56940613 GTATAACCTGGAAAACTGTGTGG - Intergenic
1070674044 10:78399687-78399709 GTAAAACCATATTAACTGTGTGG - Intergenic
1073918090 10:108429207-108429229 ATAAAACCAGGGCACCAGAGAGG + Intergenic
1083000310 11:59284934-59284956 GTCTAACCAGGTCAAATGTGTGG - Intergenic
1084388447 11:68859536-68859558 GCAAAAGCAGGGCCACTATGAGG + Intergenic
1085654319 11:78298758-78298780 GGAAAACCAGGGCAAAGCTGGGG + Intronic
1085873567 11:80379725-80379747 GAAAAAAAAGGGCAATTGTGTGG + Intergenic
1090719573 11:129459292-129459314 GTAAATTCAGGGCAACTGTGAGG - Intergenic
1093542924 12:20309205-20309227 GTAAATCCATGTCAACAGTGAGG + Intergenic
1096174818 12:49507225-49507247 TTAAAGGCAGGGCCACTGTGGGG + Intronic
1101471448 12:105000413-105000435 GAAAAAACAGAGCAACTGTTTGG - Intronic
1102063425 12:109952572-109952594 GTGAAACCAGGGCATCTAAGGGG - Intronic
1102757442 12:115354425-115354447 CAAAAACCAGGGGAACTGGGTGG - Intergenic
1103014518 12:117483436-117483458 GTAAAATGAGAGAAACTGTGGGG + Intronic
1105746351 13:23380097-23380119 GGAATCCCAGGGCCACTGTGGGG - Intronic
1107221125 13:37982073-37982095 AGAAAACTAGGGCAACTGTAGGG - Intergenic
1108342607 13:49512923-49512945 GTAAAACAGTGGCAACTTTGGGG - Intronic
1113198166 13:107833921-107833943 GTAAAACTATGGAAACTTTGAGG + Intronic
1113277292 13:108745319-108745341 GTAAAACCCAGGAAAATGTGGGG - Intronic
1116870870 14:50068219-50068241 GCAAAGCCTGGTCAACTGTGTGG + Intergenic
1127466507 15:59249600-59249622 GTCACACCAGGGAAACTGGGAGG + Intronic
1127538607 15:59915130-59915152 CTAAAACCAGGACAAGTGAGTGG - Intergenic
1136033122 16:27517936-27517958 GAAAAACCAGAGTAGCTGTGAGG + Intronic
1137272234 16:46909521-46909543 GTAAAATGAGGGCAGCTGCGAGG - Intronic
1140951658 16:79824276-79824298 GTAACACCAGGGCATTTCTGGGG - Intergenic
1141690490 16:85593712-85593734 TTAAAACCAGGGTGACTGTGTGG - Intergenic
1142312943 16:89324422-89324444 CTAAAACCAAGGTAAGTGTGAGG + Intronic
1142964346 17:3571566-3571588 CGAAGACCCGGGCAACTGTGAGG - Exonic
1143190178 17:5034792-5034814 CTAAGACCAGGGCAACTGGAGGG + Intronic
1145023312 17:19448789-19448811 GTAAAACCACAGCAGCTGTGGGG + Intergenic
1151267545 17:72968390-72968412 CTAAGACCAGGACAATTGTGTGG + Intronic
1153408998 18:4772488-4772510 ATAAAACCAGGGGAATTGTGTGG - Intergenic
1154194807 18:12257821-12257843 CTAAAAGCAGGGCCACTGAGCGG - Intronic
1155163337 18:23212987-23213009 GTAAAATCAGGGAAATTCTGTGG + Intronic
1155418547 18:25628389-25628411 GTTAAATCAGGGTAACTGTGGGG + Intergenic
1155529482 18:26752067-26752089 GTAAAACCAGAAAAACTTTGCGG - Intergenic
1159014105 18:63087785-63087807 GTAAATCAAGAGCATCTGTGTGG - Intergenic
1162993540 19:14319070-14319092 GTAACACCACGGCCACTGGGGGG - Intergenic
1163543981 19:17929947-17929969 ACAGAACTAGGGCAACTGTGGGG + Intergenic
1166289682 19:41854505-41854527 ATAAAACCTGGGTGACTGTGGGG - Intergenic
928243838 2:29610001-29610023 ACAAAACCAGGGCCAATGTGTGG - Intronic
928299611 2:30113613-30113635 GAAGGACCAAGGCAACTGTGAGG + Intergenic
934676485 2:96253249-96253271 ATAAAACCAGGGCACACGTGAGG + Exonic
937030875 2:118739245-118739267 GTCAATCCAGGGCCACTGTCTGG - Intergenic
937683745 2:124672248-124672270 GTAAAATGAGGGCAAATGGGTGG - Intronic
938240927 2:129741802-129741824 GGAAAGCCGGGGCAAGTGTGGGG - Intergenic
939020747 2:136955683-136955705 GTAAAAGCAGGGCAATCGTGAGG + Intronic
939437525 2:142198015-142198037 GGAAAATCAGGTCATCTGTGAGG + Intergenic
939469240 2:142598662-142598684 GTTAAACCATGGAAACTTTGGGG - Intergenic
943061150 2:183042805-183042827 GAAAAGACAGGGCAACAGTGAGG + Intergenic
943716202 2:191154898-191154920 TTATCACCAGGGCAACTGGGTGG - Intergenic
945752939 2:213810932-213810954 GTGAAGCCAGGACTACTGTGAGG + Intronic
1170152631 20:13241362-13241384 GAGATACCAGGGCATCTGTGAGG + Intronic
1172950702 20:38721891-38721913 GTAAAACTAGGATAAATGTGAGG + Intergenic
1174206283 20:48841884-48841906 GAGGAACAAGGGCAACTGTGGGG + Intergenic
1174431474 20:50472872-50472894 GTTAAACCAGTGCAATGGTGGGG - Intergenic
1175782539 20:61692053-61692075 GTAAAACCAGGTCCAATGAGGGG + Intronic
1176263481 20:64195905-64195927 GGAAAACCATGAAAACTGTGGGG - Intronic
1183099768 22:35576717-35576739 GAAAACCAAGGGCAACGGTGAGG + Intergenic
950345746 3:12290253-12290275 GTAAAACCATGGCATCAGTGAGG + Intronic
952529066 3:34244458-34244480 GTTACTCCAGAGCAACTGTGGGG + Intergenic
953094093 3:39757678-39757700 GTGTAACAAGGGCAACTGGGAGG + Intergenic
953140890 3:40228219-40228241 GCAAGACAAGGGCCACTGTGTGG + Intronic
955891677 3:63656862-63656884 GTGAAACCAGAGCAGTTGTGTGG + Intronic
958709487 3:97699993-97700015 ACAAAACCAGGGCAACTGGATGG + Intronic
960577732 3:119243922-119243944 GAAAAACTAGAGCAACTGTTGGG - Intergenic
962706329 3:138048271-138048293 TTAAACACAGGGGAACTGTGGGG + Intergenic
964869350 3:161296371-161296393 GTAATAGCAGGGACACTGTGAGG + Intergenic
966838496 3:184068441-184068463 GAAAAGCCAGGGGAACTGAGTGG - Intergenic
967796257 3:193601944-193601966 ACAAAACCAGGGTAACTGTTGGG - Intronic
967846018 3:194043575-194043597 CTAAAACCAGGGCAATCCTGGGG - Intergenic
969329891 4:6468352-6468374 ATAAAATCAGGACAACTCTGTGG + Intronic
970498989 4:16657630-16657652 GGAAAGCCAGGGCAGTTGTGGGG - Intronic
974344965 4:60667873-60667895 ACAAAACCAGGGCAAATGTATGG - Intergenic
974351662 4:60755610-60755632 GTAAAACCAGTGAAAGTGTGAGG - Intergenic
977809292 4:101340837-101340859 GTCAAACCAGAGCATCAGTGTGG + Intronic
978182717 4:105819545-105819567 TGAAAACCATAGCAACTGTGGGG + Intronic
978875508 4:113636197-113636219 ATAAATCCAGAGAAACTGTGAGG - Intronic
986674565 5:10171703-10171725 GGAAAAGTTGGGCAACTGTGTGG - Intergenic
989038753 5:37204330-37204352 GTAAAACCAGGGCAACTGTGAGG - Intronic
990669081 5:58107114-58107136 GTAAAACCAGGAAAACTGAGGGG - Intergenic
991740390 5:69666435-69666457 GTACAGCCTGTGCAACTGTGAGG + Intergenic
991757108 5:69886732-69886754 GTACAGCCTGTGCAACTGTGAGG - Intergenic
991791965 5:70246176-70246198 GTACAGCCTGTGCAACTGTGAGG + Intergenic
991819853 5:70542552-70542574 GTACAGCCTGTGCAACTGTGAGG + Intergenic
991836511 5:70762614-70762636 GTACAGCCTGTGCAACTGTGAGG - Intergenic
991884414 5:71246514-71246536 GTACAGCCTGTGCAACTGTGAGG + Intergenic
994120797 5:96110611-96110633 GGAAAGAGAGGGCAACTGTGAGG + Intergenic
994441718 5:99814693-99814715 CTAAAACCAGAGCAGCTGTTTGG - Intergenic
994709269 5:103246510-103246532 AGAAAACAAGGGCACCTGTGAGG - Intergenic
995018490 5:107340893-107340915 GTAGAAGCAGGGCAACTGTCAGG - Intergenic
995785794 5:115826081-115826103 CTAAAACCAGGGGAAAAGTGTGG + Intergenic
998190306 5:140018281-140018303 GCATAACCAGGTCAAATGTGGGG + Intronic
1000155710 5:158549625-158549647 CTGAAACCTGGGCAACTGTTTGG + Intergenic
1000215195 5:159148619-159148641 GGAAAAAAAGGGAAACTGTGAGG + Intergenic
1001093281 5:168757189-168757211 GTAAAACCAGGGCCACCCAGGGG + Intronic
1006193801 6:32224844-32224866 GTCAACCCAGGACAACTTTGGGG + Intergenic
1006844361 6:37052063-37052085 GTAAAACATGGGCCACAGTGGGG + Intergenic
1007088957 6:39169969-39169991 GTACAACAAGGGAAACTCTGTGG + Intergenic
1007599072 6:43070751-43070773 CCAAAACCAGGGCAAGTATGAGG + Exonic
1008255990 6:49300328-49300350 TTAAAACCAGGTCAAATTTGGGG + Intergenic
1011855633 6:91686490-91686512 TTAAAACCAAGACAATTGTGGGG + Intergenic
1014715252 6:124857123-124857145 GCAGAAACAGGGCAACTGAGAGG - Intergenic
1016970488 6:149757603-149757625 GTCAAACCAGGACAAATGGGAGG + Intronic
1022369278 7:29755371-29755393 ATAAAACCATGGAAACTTTGGGG - Intergenic
1024549936 7:50554290-50554312 TTAATAATAGGGCAACTGTGGGG + Intronic
1025044655 7:55682593-55682615 GTGACACCAAGCCAACTGTGTGG - Intergenic
1028474144 7:91235355-91235377 ATAAAACCAGAACAACTGTGAGG + Intergenic
1029863755 7:103603341-103603363 GTAAAACCAGAACAAGGGTGTGG - Exonic
1034962692 7:155372534-155372556 GTAAAACGTGGGCACCTGTCCGG - Intergenic
1035662329 8:1357547-1357569 AAAATACCAGGGCACCTGTGAGG - Intergenic
1036188604 8:6648571-6648593 GCCATAACAGGGCAACTGTGAGG + Intergenic
1039905010 8:41780180-41780202 GTGAACCCAGGCCAACTGTCTGG - Intronic
1040298541 8:46175936-46175958 GCAAAACCGGGGCAGATGTGTGG + Intergenic
1040315062 8:46256622-46256644 GTAAAAACAGGGCAGCAGGGTGG + Intergenic
1040315280 8:46257713-46257735 GCAAAACCCGGGCCACGGTGTGG + Intergenic
1040337644 8:46424178-46424200 GCGAAAACAGGGCCACTGTGTGG + Intergenic
1052806811 9:33020545-33020567 CTAAAACAAGGGTTACTGTGAGG + Intronic
1059307542 9:113366636-113366658 GTCATCCCAGGGCAAATGTGAGG - Intronic
1059693006 9:116703909-116703931 TTACAAGCAGGGCAACAGTGAGG + Intronic
1059853763 9:118372527-118372549 GTATGTCCAGGGCAACTGTAGGG + Intergenic
1060584968 9:124780143-124780165 GAAATACCAGGGAAGCTGTGGGG - Intronic
1061117878 9:128626123-128626145 TTAAAACCAGGGCAAATGAGAGG + Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1186218972 X:7328990-7329012 TTAAAACCAGGTCAACTGGCCGG - Intronic
1188442207 X:30223582-30223604 GTAAAATCAGGGAATCTGAGTGG + Intergenic
1190235034 X:48608569-48608591 GTAGAAACTGGGCATCTGTGTGG - Exonic
1194405460 X:93491311-93491333 TTAGAACCAGGGAAACTGTAGGG + Intergenic