ID: 989043121

View in Genome Browser
Species Human (GRCh38)
Location 5:37249318-37249340
Sequence AGGGCCCGCAGCTGTCGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989043121_989043131 18 Left 989043121 5:37249318-37249340 CCAGGCCGACAGCTGCGGGCCCT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 989043131 5:37249359-37249381 AGCCTGCGTCCTGGCGACGGCGG 0: 1
1: 0
2: 1
3: 6
4: 86
989043121_989043138 30 Left 989043121 5:37249318-37249340 CCAGGCCGACAGCTGCGGGCCCT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 989043138 5:37249371-37249393 GGCGACGGCGGAGGGCGGGCAGG 0: 1
1: 2
2: 6
3: 86
4: 697
989043121_989043130 15 Left 989043121 5:37249318-37249340 CCAGGCCGACAGCTGCGGGCCCT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 989043130 5:37249356-37249378 GCGAGCCTGCGTCCTGGCGACGG 0: 1
1: 0
2: 0
3: 4
4: 78
989043121_989043133 21 Left 989043121 5:37249318-37249340 CCAGGCCGACAGCTGCGGGCCCT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 989043133 5:37249362-37249384 CTGCGTCCTGGCGACGGCGGAGG 0: 1
1: 0
2: 1
3: 7
4: 97
989043121_989043134 22 Left 989043121 5:37249318-37249340 CCAGGCCGACAGCTGCGGGCCCT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 989043134 5:37249363-37249385 TGCGTCCTGGCGACGGCGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 40
989043121_989043129 9 Left 989043121 5:37249318-37249340 CCAGGCCGACAGCTGCGGGCCCT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 989043129 5:37249350-37249372 CCTGACGCGAGCCTGCGTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 66
989043121_989043136 26 Left 989043121 5:37249318-37249340 CCAGGCCGACAGCTGCGGGCCCT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 989043136 5:37249367-37249389 TCCTGGCGACGGCGGAGGGCGGG 0: 1
1: 0
2: 2
3: 10
4: 156
989043121_989043135 25 Left 989043121 5:37249318-37249340 CCAGGCCGACAGCTGCGGGCCCT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 989043135 5:37249366-37249388 GTCCTGGCGACGGCGGAGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989043121 Original CRISPR AGGGCCCGCAGCTGTCGGCC TGG (reversed) Exonic