ID: 989043123

View in Genome Browser
Species Human (GRCh38)
Location 5:37249337-37249359
Sequence TCGCGTCAGGGCTGGCGGTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989043123_989043139 12 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043139 5:37249372-37249394 GCGACGGCGGAGGGCGGGCAGGG 0: 1
1: 0
2: 3
3: 28
4: 317
989043123_989043135 6 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043135 5:37249366-37249388 GTCCTGGCGACGGCGGAGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 275
989043123_989043140 13 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043140 5:37249373-37249395 CGACGGCGGAGGGCGGGCAGGGG 0: 1
1: 0
2: 2
3: 35
4: 325
989043123_989043131 -1 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043131 5:37249359-37249381 AGCCTGCGTCCTGGCGACGGCGG 0: 1
1: 0
2: 1
3: 6
4: 86
989043123_989043141 14 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043141 5:37249374-37249396 GACGGCGGAGGGCGGGCAGGGGG 0: 1
1: 0
2: 8
3: 70
4: 722
989043123_989043142 19 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043142 5:37249379-37249401 CGGAGGGCGGGCAGGGGGCGCGG 0: 1
1: 1
2: 22
3: 227
4: 1610
989043123_989043138 11 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043138 5:37249371-37249393 GGCGACGGCGGAGGGCGGGCAGG 0: 1
1: 2
2: 6
3: 86
4: 697
989043123_989043130 -4 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043130 5:37249356-37249378 GCGAGCCTGCGTCCTGGCGACGG 0: 1
1: 0
2: 0
3: 4
4: 78
989043123_989043129 -10 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043129 5:37249350-37249372 CCTGACGCGAGCCTGCGTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 66
989043123_989043136 7 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043136 5:37249367-37249389 TCCTGGCGACGGCGGAGGGCGGG 0: 1
1: 0
2: 2
3: 10
4: 156
989043123_989043134 3 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043134 5:37249363-37249385 TGCGTCCTGGCGACGGCGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 40
989043123_989043143 20 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043143 5:37249380-37249402 GGAGGGCGGGCAGGGGGCGCGGG 0: 1
1: 2
2: 27
3: 220
4: 1679
989043123_989043133 2 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043133 5:37249362-37249384 CTGCGTCCTGGCGACGGCGGAGG 0: 1
1: 0
2: 1
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989043123 Original CRISPR TCGCGTCAGGGCTGGCGGTA GGG (reversed) Exonic