ID: 989043125

View in Genome Browser
Species Human (GRCh38)
Location 5:37249342-37249364
Sequence CAGGCTCGCGTCAGGGCTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 181}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989043125_989043130 -9 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043130 5:37249356-37249378 GCGAGCCTGCGTCCTGGCGACGG 0: 1
1: 0
2: 0
3: 4
4: 78
989043125_989043140 8 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043140 5:37249373-37249395 CGACGGCGGAGGGCGGGCAGGGG 0: 1
1: 0
2: 2
3: 35
4: 325
989043125_989043143 15 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043143 5:37249380-37249402 GGAGGGCGGGCAGGGGGCGCGGG 0: 1
1: 2
2: 27
3: 220
4: 1679
989043125_989043141 9 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043141 5:37249374-37249396 GACGGCGGAGGGCGGGCAGGGGG 0: 1
1: 0
2: 8
3: 70
4: 722
989043125_989043134 -2 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043134 5:37249363-37249385 TGCGTCCTGGCGACGGCGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 40
989043125_989043144 26 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043144 5:37249391-37249413 AGGGGGCGCGGGCGCTGCCACGG 0: 1
1: 0
2: 3
3: 30
4: 262
989043125_989043142 14 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043142 5:37249379-37249401 CGGAGGGCGGGCAGGGGGCGCGG 0: 1
1: 1
2: 22
3: 227
4: 1610
989043125_989043131 -6 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043131 5:37249359-37249381 AGCCTGCGTCCTGGCGACGGCGG 0: 1
1: 0
2: 1
3: 6
4: 86
989043125_989043133 -3 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043133 5:37249362-37249384 CTGCGTCCTGGCGACGGCGGAGG 0: 1
1: 0
2: 1
3: 7
4: 97
989043125_989043136 2 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043136 5:37249367-37249389 TCCTGGCGACGGCGGAGGGCGGG 0: 1
1: 0
2: 2
3: 10
4: 156
989043125_989043139 7 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043139 5:37249372-37249394 GCGACGGCGGAGGGCGGGCAGGG 0: 1
1: 0
2: 3
3: 28
4: 317
989043125_989043135 1 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043135 5:37249366-37249388 GTCCTGGCGACGGCGGAGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 275
989043125_989043138 6 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043138 5:37249371-37249393 GGCGACGGCGGAGGGCGGGCAGG 0: 1
1: 2
2: 6
3: 86
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989043125 Original CRISPR CAGGCTCGCGTCAGGGCTGG CGG (reversed) Exonic