ID: 989043130

View in Genome Browser
Species Human (GRCh38)
Location 5:37249356-37249378
Sequence GCGAGCCTGCGTCCTGGCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989043122_989043130 10 Left 989043122 5:37249323-37249345 CCGACAGCTGCGGGCCCTACCGC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 989043130 5:37249356-37249378 GCGAGCCTGCGTCCTGGCGACGG 0: 1
1: 0
2: 0
3: 4
4: 78
989043124_989043130 -5 Left 989043124 5:37249338-37249360 CCTACCGCCAGCCCTGACGCGAG 0: 1
1: 0
2: 0
3: 9
4: 85
Right 989043130 5:37249356-37249378 GCGAGCCTGCGTCCTGGCGACGG 0: 1
1: 0
2: 0
3: 4
4: 78
989043123_989043130 -4 Left 989043123 5:37249337-37249359 CCCTACCGCCAGCCCTGACGCGA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 989043130 5:37249356-37249378 GCGAGCCTGCGTCCTGGCGACGG 0: 1
1: 0
2: 0
3: 4
4: 78
989043125_989043130 -9 Left 989043125 5:37249342-37249364 CCGCCAGCCCTGACGCGAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 989043130 5:37249356-37249378 GCGAGCCTGCGTCCTGGCGACGG 0: 1
1: 0
2: 0
3: 4
4: 78
989043121_989043130 15 Left 989043121 5:37249318-37249340 CCAGGCCGACAGCTGCGGGCCCT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 989043130 5:37249356-37249378 GCGAGCCTGCGTCCTGGCGACGG 0: 1
1: 0
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989043130 Original CRISPR GCGAGCCTGCGTCCTGGCGA CGG Exonic