ID: 989045210

View in Genome Browser
Species Human (GRCh38)
Location 5:37267620-37267642
Sequence GGTTATCTGAAGAAGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989045207_989045210 4 Left 989045207 5:37267593-37267615 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 989045210 5:37267620-37267642 GGTTATCTGAAGAAGATGGTAGG No data
989045203_989045210 22 Left 989045203 5:37267575-37267597 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 989045210 5:37267620-37267642 GGTTATCTGAAGAAGATGGTAGG No data
989045204_989045210 16 Left 989045204 5:37267581-37267603 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 989045210 5:37267620-37267642 GGTTATCTGAAGAAGATGGTAGG No data
989045205_989045210 15 Left 989045205 5:37267582-37267604 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 989045210 5:37267620-37267642 GGTTATCTGAAGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989045210 Original CRISPR GGTTATCTGAAGAAGATGGT AGG Intergenic
No off target data available for this crispr