ID: 989059557

View in Genome Browser
Species Human (GRCh38)
Location 5:37396978-37397000
Sequence ACAAAAATGCAAAAATTAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141265
Summary {0: 2, 1: 60, 2: 2102, 3: 17456, 4: 121645}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989059556_989059557 10 Left 989059556 5:37396945-37396967 CCAGCTTGGGCAACATGGCGAAA 0: 128
1: 3803
2: 38389
3: 169313
4: 257938
Right 989059557 5:37396978-37397000 ACAAAAATGCAAAAATTAGACGG 0: 2
1: 60
2: 2102
3: 17456
4: 121645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989059557 Original CRISPR ACAAAAATGCAAAAATTAGA CGG Intronic
Too many off-targets to display for this crispr