ID: 989064170

View in Genome Browser
Species Human (GRCh38)
Location 5:37443138-37443160
Sequence AATCCCACCCCCTATGTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 3, 1: 0, 2: 1, 3: 4, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989064170_989064172 -7 Left 989064170 5:37443138-37443160 CCTATAACATAGGGGGTGGGATT 0: 3
1: 0
2: 1
3: 4
4: 84
Right 989064172 5:37443154-37443176 TGGGATTAAAGAACAGAAATGGG 0: 3
1: 0
2: 3
3: 38
4: 603
989064170_989064173 -4 Left 989064170 5:37443138-37443160 CCTATAACATAGGGGGTGGGATT 0: 3
1: 0
2: 1
3: 4
4: 84
Right 989064173 5:37443157-37443179 GATTAAAGAACAGAAATGGGAGG 0: 1
1: 0
2: 1
3: 35
4: 450
989064170_989064174 27 Left 989064170 5:37443138-37443160 CCTATAACATAGGGGGTGGGATT 0: 3
1: 0
2: 1
3: 4
4: 84
Right 989064174 5:37443188-37443210 GACCATATGTCATTTTGCTCCGG 0: 1
1: 0
2: 0
3: 11
4: 115
989064170_989064171 -8 Left 989064170 5:37443138-37443160 CCTATAACATAGGGGGTGGGATT 0: 3
1: 0
2: 1
3: 4
4: 84
Right 989064171 5:37443153-37443175 GTGGGATTAAAGAACAGAAATGG 0: 3
1: 0
2: 5
3: 41
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989064170 Original CRISPR AATCCCACCCCCTATGTTAT AGG (reversed) Intronic
904589945 1:31607544-31607566 GATCCCACGCCCCATGTCATGGG - Intergenic
904918492 1:33987234-33987256 AATGATACCCCCTATGCTATAGG + Intronic
906977106 1:50587817-50587839 ATTCCTACCCCCTATGATTTAGG - Intronic
918414232 1:184290114-184290136 CATCCCACCCCCTAGGCTAAGGG - Intergenic
923887115 1:238170063-238170085 AATCCTAACCCCTATGGTGTTGG - Intergenic
1063521318 10:6743771-6743793 AATCCCAGCACCCTTGTTATGGG - Intergenic
1070364769 10:75725966-75725988 AATCCCACTCCCTAGGGGATAGG - Intronic
1073371620 10:102995012-102995034 AACCCTATCCCCTATATTATGGG + Intronic
1075082793 10:119395149-119395171 AATCCCACCCCTCATTTTATAGG - Intronic
1084351877 11:68607536-68607558 AATCCCAGTACCTATCTTATAGG - Intronic
1084664119 11:70567066-70567088 AATGCCACCACCATTGTTATCGG + Intronic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088901561 11:114121592-114121614 AATACCAGTCCCTATGTCATGGG - Intronic
1090267348 11:125361699-125361721 TATCCCACCCCATCTTTTATGGG + Intronic
1100380658 12:94058725-94058747 AATGCCACCACCTATATTGTAGG + Intergenic
1100903832 12:99274671-99274693 AAACCTACACCATATGTTATAGG + Intronic
1106067954 13:26375973-26375995 ACTCCCACCCCCTACTTTTTTGG - Intronic
1107406875 13:40122741-40122763 AGTACCACTCCCTATGTTACAGG - Intergenic
1112682715 13:101785871-101785893 GACCCCACTCCCTATGTTTTAGG + Intronic
1114899527 14:27039439-27039461 AATCCCAACACCTTTGGTATTGG + Intergenic
1115473144 14:33789294-33789316 CATCCCACCCTCCAAGTTATAGG - Intronic
1121914252 14:97821418-97821440 AATCCCTCCCCATATGTCAAAGG + Intergenic
1122389366 14:101369804-101369826 AAGCACACCCCTTATGTTTTGGG + Intergenic
1126050458 15:44680393-44680415 AACCTCACCTCTTATGTTATGGG + Intronic
1139289868 16:65848000-65848022 AATGCCACCCACCATGTTCTTGG + Intergenic
1139630110 16:68225998-68226020 AATGCCACCTCCTATGTAAATGG - Intronic
1145766081 17:27459043-27459065 AAACTTAACCCCTATGTTATGGG - Intronic
1151293480 17:73166423-73166445 AATCACAGCCCCTATGTAAAAGG + Intronic
1154091159 18:11364688-11364710 ATGCACACCCCCTATGGTATAGG + Intergenic
1155038063 18:22042066-22042088 AAACACAGCCCCTATGTGATGGG - Intergenic
1158416303 18:57252370-57252392 AATTACACCCCCTGTGTGATAGG + Intergenic
1161058532 19:2202476-2202498 AATCCTGCCCCCTCTGTTTTTGG + Intronic
1161127861 19:2569995-2570017 AATGCGACCCCCTATGTTGGAGG + Intronic
928392450 2:30919884-30919906 AGTCCCCTCCCTTATGTTATGGG - Intronic
937190221 2:120088700-120088722 ACTCCCACCAGCAATGTTATTGG + Intronic
1173212560 20:41047276-41047298 AATACCACCTTCTATCTTATGGG - Intronic
1174617571 20:51847771-51847793 AAACCAAGCCCCTGTGTTATTGG - Intergenic
1181424581 22:22825439-22825461 AATTCCACCGCATATGTTCTAGG + Intronic
951864871 3:27297082-27297104 AATCCCAAAACCTATGTTCTGGG + Intronic
952657748 3:35807143-35807165 AATCCTACCCCCTGTGTTGTTGG + Intergenic
954846349 3:53561393-53561415 GATCCAATCCCCTATTTTATAGG - Intronic
956204351 3:66740257-66740279 AATCCCTTCACCTATGTTACTGG + Intergenic
959175003 3:102897078-102897100 AATGCCACCTCCTTTGTTTTTGG - Intergenic
963161402 3:142154105-142154127 AAGCCAACCCCATGTGTTATGGG + Intergenic
964236208 3:154532333-154532355 AAACCCAGCCCCTAATTTATTGG + Intergenic
964525974 3:157615666-157615688 AATAACACCACCTATGTTGTAGG - Intronic
969361576 4:6667463-6667485 AATCCTACCCGCAATGTGATGGG + Intergenic
970968790 4:21957652-21957674 AATCCCAACCCCTAAGGTAATGG + Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
972805025 4:42520645-42520667 ACTCCCACCCTAAATGTTATAGG - Intronic
975159952 4:71113674-71113696 AATCTCACTCCATAAGTTATGGG - Intergenic
982777919 4:159461083-159461105 TATCCCTGCCCCTTTGTTATGGG - Intergenic
983641575 4:169948249-169948271 AATCCCATCTCCTACTTTATGGG - Intergenic
985852038 5:2395839-2395861 AATACCACCCCCTACTTCATAGG + Intergenic
989064170 5:37443138-37443160 AATCCCACCCCCTATGTTATAGG - Intronic
989161992 5:38400078-38400100 AATCCTACTCCTTATTTTATTGG + Intronic
993700865 5:91117550-91117572 AATCCCTGCTCATATGTTATTGG - Intronic
994417983 5:99498970-99498992 AATCCCACCCCCTATGTTATAGG - Intergenic
994461982 5:100076183-100076205 AATCCCACCCCCTATGTTATAGG + Intergenic
996687617 5:126301297-126301319 AAACAAACCCCCTCTGTTATTGG + Intergenic
999400732 5:151262378-151262400 AATCACAGCTCCTACGTTATGGG + Intronic
999795480 5:154985460-154985482 AATCCCACTCCCTAAGTTTCTGG - Intergenic
1000037078 5:157457201-157457223 AATCTCTCACCCTATGTTCTTGG + Intronic
1003271264 6:4609930-4609952 ACTCCCACCACCTCTGATATAGG - Intergenic
1003889852 6:10554455-10554477 AATCCAAACCCCCATGTTATTGG + Intronic
1005916364 6:30355525-30355547 ACTCTCACCTCCTATGTTCTTGG + Intergenic
1007097889 6:39225519-39225541 AATCACACCCCCACTGTTTTTGG + Intronic
1012903992 6:105042960-105042982 AAGCCCAACCCCTCTGCTATGGG + Intronic
1028983945 7:96995739-96995761 CATCCCACCCCCCATGTTTGGGG + Intergenic
1030238264 7:107291178-107291200 AATACCAACATCTATGTTATAGG - Intronic
1030869314 7:114735435-114735457 AACCCCACCCTCTGTGTTTTGGG - Intergenic
1035398776 7:158551567-158551589 AACCCCACCCCTGATGTGATGGG - Intronic
1035398837 7:158551793-158551815 AACCCCACCCCTGATGTGATGGG - Intronic
1035398899 7:158552019-158552041 AACCCCACCCCTGATGTGATGGG - Intronic
1035516716 8:239822-239844 AGTCCCACCCCCTATCCTTTGGG - Intronic
1036038376 8:5045342-5045364 ATTCCCACCTCCTATGTATTTGG - Intergenic
1041867447 8:62592986-62593008 AAACTCTCCCCCTATGTTAATGG - Intronic
1042870853 8:73397921-73397943 AATCCCAGCCCCCATGGTAATGG + Intergenic
1042987596 8:74601366-74601388 CAGCCTACCCCTTATGTTATGGG - Intronic
1043853726 8:85242398-85242420 TATCCCTCTCCCTCTGTTATTGG + Intronic
1043968574 8:86506129-86506151 AATCCCACCACCTATCTGGTGGG + Intronic
1045692058 8:104769908-104769930 AACCCCACCCCCCATCTTCTGGG - Intronic
1048344342 8:133565726-133565748 ATTCCCACTCCCTCTGTTACAGG - Intronic
1052642423 9:31186009-31186031 CATCCCACCCTCTATCTTCTAGG - Intergenic
1055696997 9:78895891-78895913 AATTCCACTCTCTATGTGATGGG - Intergenic
1056417163 9:86387991-86388013 AATCTCACCCCCAAAGTGATTGG + Intergenic
1057400636 9:94720263-94720285 AATCCTACCCTCTAGGTTCTTGG - Intergenic
1057774448 9:97995245-97995267 AACCCAACCCCTTATTTTATAGG + Intronic
1060788943 9:126472504-126472526 AATCCCACCCCCTATTTTAAAGG - Intronic
1185939259 X:4296891-4296913 AATGCCACGCCCTATGTTCTTGG - Intergenic
1187891981 X:23945143-23945165 AATCCCTTCCCCACTGTTATGGG + Intergenic
1196549728 X:117009392-117009414 ACACCCACCCCCAATATTATAGG - Intergenic