ID: 989066573

View in Genome Browser
Species Human (GRCh38)
Location 5:37468404-37468426
Sequence TGTAATTATCTCCATGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 16, 2: 4, 3: 21, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989066573 Original CRISPR TGTAATTATCTCCATGTGGT AGG (reversed) Intronic
901837206 1:11932083-11932105 TGTGATTATTTCCAGGTTGTGGG - Intergenic
902935875 1:19764187-19764209 TCCACTTATCTCCATGTGGGAGG + Intronic
906094328 1:43210566-43210588 TGTACTTATCTTTTTGTGGTTGG - Exonic
910735790 1:90455513-90455535 TGTAATCATTTCCATATTGTTGG - Intergenic
912480838 1:109981128-109981150 TGTAAATATCCCCATGTGGGTGG - Intergenic
912621316 1:111162024-111162046 TGTAAACAACTCCATATGGTTGG + Intronic
915547484 1:156609392-156609414 AGTCATTTTCTCTATGTGGTAGG + Intergenic
916847798 1:168670980-168671002 TGTAAATAGCTCCATATGGCTGG + Intergenic
918451011 1:184658599-184658621 GGTAGTTATCTCCAGGTAGTGGG + Intergenic
918578837 1:186100385-186100407 TTTAATTCTATCCATGTGGTGGG + Intronic
918862558 1:189850424-189850446 TAAATTTATCTCCAAGTGGTTGG - Intergenic
919851502 1:201676107-201676129 TGGAATTATCTCCTTTTGGTAGG - Intronic
921492037 1:215789071-215789093 TATAAATGTCTCCAGGTGGTAGG + Intronic
1063848554 10:10160053-10160075 TCTAATTCTCTCCAGGTGCTTGG - Intergenic
1063932214 10:11040234-11040256 TTGAATTATCTCCATATTGTTGG - Intronic
1064799958 10:19059292-19059314 TGGAATTATCTCTGTGTGTTGGG + Intronic
1067786465 10:49253091-49253113 TTTAATTATTTCCCTATGGTTGG - Intergenic
1073689447 10:105791539-105791561 TCTATCTATCTCCATGAGGTTGG - Intergenic
1073911713 10:108352593-108352615 TATAATTATCTCCATTTTGCAGG - Intergenic
1075288401 10:121207242-121207264 TGTAACCATCCCTATGTGGTAGG + Intergenic
1076379828 10:130017326-130017348 TGTTATTGTCTCCATTTTGTGGG + Intergenic
1078884239 11:15484160-15484182 TGTCACTAACTCTATGTGGTAGG + Intergenic
1079640365 11:22797359-22797381 TGTAATTGTTTCCCTCTGGTGGG - Intronic
1080044499 11:27795016-27795038 GGTAATTATCAGCATGTGGATGG + Intergenic
1080294822 11:30714558-30714580 AGTAATAATATCCATGTGGTAGG + Intergenic
1080909129 11:36577660-36577682 TGTTATTATCTCCATTTGATGGG + Exonic
1083190261 11:61046429-61046451 GGTGGTTATCTCCAGGTGGTAGG - Intergenic
1083512614 11:63225989-63226011 TTTAATTATTTCAATGTGTTTGG + Intronic
1086181118 11:83952782-83952804 AGTAATTATCTCTCTGTGGTAGG + Intronic
1087125335 11:94620089-94620111 TGTAAGTCTCTGCATATGGTCGG - Exonic
1087531677 11:99389746-99389768 TGGAATTTTCCCCAAGTGGTAGG + Intronic
1087654456 11:100905660-100905682 TGTAATTATATCCTTGTACTTGG - Intronic
1089473242 11:118737842-118737864 TGTAATAATCCCCATGTGTCAGG + Intergenic
1091474382 12:757475-757497 TGTAATTAGCTGGGTGTGGTGGG - Intronic
1092674646 12:10901863-10901885 TGTAATTATTTCCATAAGGTAGG - Intronic
1093038297 12:14353617-14353639 TGGAATTATGTCCATGTCCTAGG + Intergenic
1096902023 12:54893382-54893404 TGCGTTTATCTCCATGTGTTTGG + Intergenic
1099032186 12:77540210-77540232 TGTAATTAAGTGAATGTGGTAGG + Intergenic
1099961184 12:89398635-89398657 TGTAATTGTTTCCTTATGGTTGG - Intergenic
1100014431 12:89991804-89991826 TTTTATTATCTTCATGTTGTTGG - Intergenic
1101238755 12:102816537-102816559 AGTAATTATATCTATGTGCTAGG + Intergenic
1105523357 13:21151853-21151875 TGTAATTAACTCTTTGAGGTAGG - Intergenic
1107009654 13:35655932-35655954 TGGAAGTCTCTCCATGTTGTAGG - Intronic
1107096242 13:36539718-36539740 TGTAATAATCCCCATGTGTCAGG + Intergenic
1108264707 13:48694948-48694970 TTTAATTATCTCCAAATGGAGGG - Intronic
1108465937 13:50715404-50715426 GGTACTAATCTCTATGTGGTAGG - Intronic
1109040399 13:57328185-57328207 TGCAGTTATTTGCATGTGGTTGG + Intergenic
1109870079 13:68322380-68322402 CGTAATAATCCCCATGTAGTGGG - Intergenic
1110271763 13:73599233-73599255 TGGAATAATCTCCATGTGAATGG - Intergenic
1111052608 13:82905060-82905082 TGTAATAATTCCCATGTGTTTGG + Intergenic
1111357801 13:87132577-87132599 TGTAATTATTTCCAGGTGCCTGG - Intergenic
1111562278 13:89966974-89966996 TGTAATTAAATCCTTGTCGTAGG - Intergenic
1114776035 14:25482664-25482686 GGAAAGTATCTGCATGTGGTAGG - Intergenic
1114921778 14:27341826-27341848 TGTAATAATCCCCATGTGTTGGG + Intergenic
1117600655 14:57370952-57370974 TGTGATTATCTCTAGGTGTTAGG - Intergenic
1120919702 14:89743719-89743741 TGTTATTATCTCCATTTCATTGG + Intergenic
1122394431 14:101413189-101413211 TTTAATTATTTCCAAGTTGTGGG + Intergenic
1125136827 15:36353585-36353607 TGCTATTATCTCCATTTCGTGGG + Intergenic
1125383964 15:39116166-39116188 TGTAATTATGTTCATGTGAGTGG - Intergenic
1125688878 15:41580556-41580578 GGTGATTATCTCTAGGTGGTGGG - Exonic
1133147306 16:3798639-3798661 TTTTATTATAGCCATGTGGTGGG - Intronic
1133998278 16:10763495-10763517 TGTACTTTTCTGCATGTTGTTGG - Intronic
1134003132 16:10798375-10798397 TGTGATTATCTCCATTTTGCAGG - Intronic
1134008825 16:10836093-10836115 TTTAATTTTATTCATGTGGTTGG - Intergenic
1135707729 16:24689202-24689224 GGTTAGTATCTCCAAGTGGTTGG - Intergenic
1137537147 16:49336068-49336090 TGTAATTTACTACATGTAGTGGG - Intergenic
1138499734 16:57432728-57432750 TGTAACTATCAGCAAGTGGTTGG - Intronic
1140696320 16:77537800-77537822 TGTGATTATCTCCATTTCATAGG - Intergenic
1142787966 17:2239628-2239650 TGGAGTTATCTCTAGGTGGTAGG + Intronic
1143142470 17:4748957-4748979 TGTGGTTATCTCCCAGTGGTGGG + Intergenic
1145302617 17:21651832-21651854 AGTGATTATCTCTGTGTGGTAGG + Intergenic
1145347685 17:22051356-22051378 AGTGATTATCTCTGTGTGGTAGG - Intergenic
1145415905 17:22713970-22713992 AGTGATTATCTCTGTGTGGTAGG + Intergenic
1146470377 17:33119755-33119777 TGTAAGCATCTCCATGTGGCAGG + Intronic
1146700941 17:34959666-34959688 TGATATTAACTTCATGTGGTAGG + Intronic
1149850945 17:60033330-60033352 TGTGATTATCTCCATGTGGCAGG + Intergenic
1149859221 17:60113194-60113216 TGTGATTATCTCCATGTGGCAGG - Intergenic
1152152538 17:78611420-78611442 TTCAATTATCTACGTGTGGTAGG + Intergenic
1152930749 17:83108370-83108392 TGTGTTTATCTCCAGGTGATGGG - Intergenic
1153079315 18:1202530-1202552 TCTAGTTATCTCTATGTGATTGG + Intergenic
1154369543 18:13747164-13747186 TATAATTACCTCCATGAAGTAGG + Intronic
1156052229 18:32951542-32951564 TTTAATTATCTCCACCAGGTTGG + Intronic
1158009214 18:52709135-52709157 TGTAATTATCTCCATTTTATTGG + Intronic
1158263477 18:55634695-55634717 TGTATTTATGACCTTGTGGTAGG + Intronic
1165282812 19:34812729-34812751 TGTAAGTATCTCAAAGAGGTGGG + Intergenic
925820100 2:7791781-7791803 TGTTGTTATGTCCATTTGGTTGG - Intergenic
926309373 2:11663665-11663687 TGTAATTCTATCCCTGTGCTGGG - Intronic
926345323 2:11939711-11939733 TGTAATTAGCAGCATGTGGTTGG + Intergenic
929948759 2:46390066-46390088 TGTACTTAACTCCATGAGCTGGG + Intergenic
929987614 2:46751538-46751560 AGTGATTATCTCTAGGTGGTGGG + Intronic
930847485 2:55922000-55922022 TGGTTTTATCTGCATGTGGTAGG + Intronic
930858865 2:56049053-56049075 TGTAGTTATGTGCTTGTGGTGGG - Intergenic
931033783 2:58213895-58213917 TGTGACTATCTCCAGGTAGTTGG + Intronic
932888119 2:75565508-75565530 TGAAATCATCCTCATGTGGTAGG + Intronic
934764424 2:96872579-96872601 TTTAATTATCTCCATGACTTGGG - Intergenic
934764428 2:96872620-96872642 TTTAATTATCTCCATGACTTGGG - Intergenic
935102066 2:100006511-100006533 TGTGGTTAACTTCATGTGGTAGG - Intronic
936648883 2:114403765-114403787 TCTAATGCTCTCCATATGGTAGG - Intergenic
939222094 2:139315407-139315429 TCTAATTATCTCCAGGAGGATGG - Intergenic
941126944 2:161595523-161595545 TGTAATAAATTCCCTGTGGTTGG + Intronic
941683222 2:168421324-168421346 TGGAATAATCGCCATTTGGTGGG + Intergenic
945082621 2:206101269-206101291 TCTAAATATATTCATGTGGTAGG - Intergenic
945343772 2:208688317-208688339 TCCAATTATCTGCATGTGGCTGG + Intronic
946726430 2:222665932-222665954 ATTAATTTTCTCCATGGGGTGGG - Intergenic
946939550 2:224756816-224756838 TGTAATAGGCTGCATGTGGTGGG - Intergenic
948008972 2:234635598-234635620 TGTAATAATCCCCATGTGTCAGG + Intergenic
948102560 2:235386491-235386513 TGTGTTTATCTGTATGTGGTGGG - Intergenic
1169271499 20:4202878-4202900 AGTAATTATCTCCATGAAGCAGG - Intergenic
1170109093 20:12785487-12785509 TGTACCTCTCTCCATGTGGCAGG - Intergenic
1170316318 20:15044651-15044673 TGTGATTGTCTACATGTGCTGGG + Intronic
1170409493 20:16073292-16073314 AATCAATATCTCCATGTGGTAGG - Intergenic
1172375258 20:34433896-34433918 GGTAATTATCTCCAGGATGTAGG + Intronic
1172590963 20:36117591-36117613 TATAATTATCCCCATTTTGTGGG + Intronic
1172887887 20:38243883-38243905 TGTTGTCATCTCCATGTGTTAGG + Intronic
1173393753 20:42658999-42659021 TTGTATAATCTCCATGTGGTGGG + Intronic
1174927108 20:54772451-54772473 TTAAAATATATCCATGTGGTAGG + Intergenic
1175837745 20:62007061-62007083 AGTACTTATTTCCATGTGTTGGG - Intronic
1178025190 21:28458186-28458208 AGTCATCATCTCCATGTAGTAGG - Intergenic
1179776229 21:43664944-43664966 TGTAATAATCCCCACGTGGTGGG - Intronic
1181897981 22:26127639-26127661 TATTATTATCTCCATGTTGCAGG + Intergenic
950293372 3:11805887-11805909 TGTAATAATCCCCACGTCGTGGG + Intronic
951768381 3:26226176-26226198 TATTAGTATCTCCATGTAGTTGG - Intergenic
952205369 3:31176265-31176287 TGTATTCATCTCTATGTGCTCGG - Intergenic
954221107 3:49154474-49154496 TGGAATTATCACCATGGGGAAGG - Intergenic
954249869 3:49358966-49358988 GGTAATCATTTCCATGTTGTTGG + Intergenic
954260670 3:49436425-49436447 GGTAATTCTCTCCCTGGGGTTGG - Intergenic
955121133 3:56059383-56059405 TATAAATATCTCTATGTGGCCGG - Intronic
956919236 3:73908949-73908971 TGTCATAATCCCCATGTGTTGGG + Intergenic
957903125 3:86522995-86523017 TTTAATTCTGACCATGTGGTAGG - Intergenic
958112907 3:89172788-89172810 TGTAATTATGTGCATGTCATAGG + Intronic
959643939 3:108676007-108676029 TGAGATTACTTCCATGTGGTTGG + Intronic
962027754 3:131566588-131566610 TGGAATTATCTGCATGAGTTTGG - Intronic
963489697 3:145983951-145983973 TGTAATTATTTTAATGTGATAGG - Intergenic
963865648 3:150357724-150357746 TGCTATTATCTCCACATGGTGGG + Intergenic
964408543 3:156375360-156375382 TGTTATTATCTCCATTTGTTAGG + Intronic
966310709 3:178590527-178590549 TATTATTATTTCCAAGTGGTAGG - Intronic
967205500 3:187116865-187116887 TCTAATTTTCCCCATCTGGTAGG - Intergenic
967611742 3:191514526-191514548 AGTGATTATCTCCACGTGGTAGG - Intergenic
967633464 3:191774446-191774468 TGTAATTATTTACAGGTGTTAGG - Intergenic
969552167 4:7877526-7877548 TGTTATTATCCCCGTGTTGTAGG + Intronic
969951239 4:10837915-10837937 TTTAAGTATCTACATGTGGCTGG - Intergenic
971066032 4:23034688-23034710 TATAATTATTTTCATGTGGGTGG + Intergenic
971780800 4:31032092-31032114 TATAATTATCTGCATGTGTCAGG + Intronic
974913710 4:68153806-68153828 AGTGATTATCTCCAGGTGATGGG - Intergenic
976135124 4:81927397-81927419 TGTTATGATCCCCATGTGTTGGG - Intronic
976446351 4:85134314-85134336 TTTAATTAGCTCAATTTGGTGGG + Intergenic
977055545 4:92185848-92185870 TAAAATTATCTACATGTGGTTGG - Intergenic
977756840 4:100682083-100682105 TGTATTTATCTGTATGTGGTAGG - Intronic
977839496 4:101685125-101685147 TGTAATTATGTACAGGTGGAGGG + Intronic
977952994 4:102994901-102994923 TGTAATAATCCCCATGTGTCAGG - Intronic
978158652 4:105518751-105518773 TGTAATTATCTCTTGGGGGTGGG - Intergenic
978881297 4:113705938-113705960 TATAACTTTCTGCATGTGGTGGG + Intronic
979147679 4:117265502-117265524 TCTAATTATTTACATGTTGTGGG - Intergenic
981042963 4:140239865-140239887 TGTAATTACCTGCATGGAGTTGG + Intergenic
981609758 4:146580757-146580779 TGAAATTATCTGCATGTAGGTGG + Intergenic
981785304 4:148471524-148471546 TGTAATTATATATATCTGGTGGG + Intergenic
986510763 5:8504250-8504272 AGCAATTATCTCACTGTGGTAGG + Intergenic
986864915 5:11974779-11974801 TGTAATAATCTCCAAGTGTCGGG - Intergenic
987707999 5:21479667-21479689 TGTAATTATCTCCATCTGGTAGG - Intergenic
988524646 5:31976507-31976529 TGTAAACATCCCCTTGTGGTTGG + Intronic
988751782 5:34195288-34195310 TGTAATCATCTCCATCTGGTAGG + Intergenic
989066573 5:37468404-37468426 TGTAATTATCTCCATGTGGTAGG - Intronic
990180320 5:53153720-53153742 TGTAAGTATGTCCATGTGTATGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990740450 5:58907402-58907424 TGCAATTGTCTCTTTGTGGTAGG + Intergenic
991243999 5:64489774-64489796 TGTAATAATCCCCATGTGTCAGG - Intergenic
991709512 5:69394569-69394591 TGTAAATAGCTACATGTGGTTGG - Intronic
991737109 5:69638062-69638084 TGTAATTATCTCCATCTGGTAGG + Intergenic
991739545 5:69656095-69656117 TGTAATTATCTCCATCTGGTAGG + Intergenic
991757957 5:69897084-69897106 TGTAATTATCTCCATCTGGTAGG - Intergenic
991788683 5:70217786-70217808 TGTAATTATCTCCATCTGGTAGG + Intergenic
991791120 5:70235836-70235858 TGTAATTATCTCCATCTGGTAGG + Intergenic
991813433 5:70492891-70492913 TGTAATTATCTCCATCTGGTAGG + Intergenic
991816565 5:70514172-70514194 TGTAATTATCTCCATCTGGTAGG + Intergenic
991819005 5:70532213-70532235 TGTAATTATCTCCATCTGGTAGG + Intergenic
991837360 5:70772966-70772988 TGTAATTATCTCCATCTGGTAGG - Intergenic
991881129 5:71218150-71218172 TGTAATTATCTCCATCTGGTAGG + Intergenic
991883566 5:71236171-71236193 TGTAATTATCTCCATCTGGTAGG + Intergenic
992211890 5:74488189-74488211 AGTAATTACCTTCAGGTGGTAGG + Intergenic
992229097 5:74645886-74645908 TGTCATTATCTCCAAGTGATAGG - Intronic
992721194 5:79562957-79562979 TGTGATTAACTCAAGGTGGTGGG + Intergenic
994420069 5:99520636-99520658 TGTAATTATCTCCATCTGGTAGG - Intergenic
994487139 5:100394503-100394525 TGTAATTATCTCCATCTGGTAGG + Intergenic
995561202 5:113383584-113383606 AGTTATTATTTCCAGGTGGTAGG + Intronic
997734329 5:136202395-136202417 AGTAATTATCTCTAGGTGGCTGG + Intergenic
997784262 5:136693469-136693491 TGTTATTATCTCAAAGTGCTGGG + Intergenic
997968297 5:138377919-138377941 TGTACTTATCTCCTTTTTGTGGG + Intronic
998027959 5:138836842-138836864 AGTAATTATCTCTAGCTGGTGGG + Intronic
1000133484 5:158321897-158321919 TATTATTATCTCTATTTGGTGGG + Intergenic
1002385633 5:178864554-178864576 AGTGATTATCTCCAGATGGTGGG - Intronic
1003046822 6:2740826-2740848 TGTTGTTGTCACCATGTGGTGGG + Intronic
1004591547 6:17056455-17056477 TGGAATAATCTTCATGGGGTGGG - Intergenic
1004718748 6:18245817-18245839 TGTAATAATCCCCACGTTGTGGG + Intronic
1005439623 6:25852512-25852534 TATAATTTTCTCTGTGTGGTGGG + Intronic
1005549942 6:26901973-26901995 TGTAATTATCTCCATCTGGTAGG + Intergenic
1007052661 6:38847998-38848020 TGTAATTCTCTCTCTGTGGGTGG + Intronic
1008018642 6:46550418-46550440 TAGAGTTATCTCCATTTGGTGGG - Exonic
1008225473 6:48909742-48909764 TTTAATTAGCTGCATGTAGTAGG + Intergenic
1009020204 6:57940871-57940893 TGTAATTATCTCCATCTGGTAGG + Intergenic
1009774411 6:68187112-68187134 TTTAATTATCTTAATGAGGTAGG + Intergenic
1011055886 6:83203005-83203027 TTTAATTTTCTCCATGTTGTGGG + Intergenic
1011470634 6:87704348-87704370 TGTAATTAGCTAAATGTAGTAGG + Intergenic
1012612523 6:101233186-101233208 TGTAAGTATCTCCATCTGTTTGG + Intergenic
1012896202 6:104953014-104953036 TGCATTTGTCTCCATGTCGTAGG + Intergenic
1013879174 6:114873657-114873679 TCAAATTAATTCCATGTGGTTGG + Intergenic
1014141582 6:117949646-117949668 TGTAATTATCGCCTTCAGGTTGG + Intronic
1014553273 6:122813846-122813868 TCTAATTATCTCTAAGTGGGAGG + Intergenic
1017326485 6:153146505-153146527 TGAAAATATATACATGTGGTAGG + Intergenic
1018875361 6:167817766-167817788 TGTAATTATAGTTATGTGGTTGG - Intergenic
1018875364 6:167817809-167817831 TGTAATTATAGTTATGTGGTTGG - Intergenic
1019756163 7:2771784-2771806 GGTAAATATCTACATGTGGAAGG + Intronic
1023179098 7:37463205-37463227 TGTATTTATTTACCTGTGGTTGG + Intergenic
1024454369 7:49586359-49586381 TGGAATTATCTGCATATGGGAGG + Intergenic
1025784831 7:64634813-64634835 TGCAATTTTCTCCATGTGTAAGG - Intergenic
1027822570 7:83065903-83065925 TTTGATTATCTTCTTGTGGTTGG + Intronic
1030768744 7:113445710-113445732 AATGATTGTCTCCATGTGGTAGG + Intergenic
1031772227 7:125858434-125858456 TGAAATAATGTCCTTGTGGTAGG - Intergenic
1033378866 7:140792622-140792644 GGTAATAAACTCCATCTGGTTGG - Intronic
1037532084 8:19787249-19787271 TATAATCATTTCCATGTTGTTGG - Intergenic
1037909576 8:22735952-22735974 GGCAATTGTCTCTATGTGGTAGG - Intronic
1041066735 8:54089861-54089883 TGTAATAATCCCCATGTGTAGGG + Intronic
1043909656 8:85846990-85847012 TGTTATTATCTCAAAGTGTTGGG + Intergenic
1045160528 8:99537750-99537772 TGTAATTCTTTTCATGTGTTTGG + Intronic
1045533580 8:103006478-103006500 GGTAAATATATCCATGTGCTGGG - Intergenic
1050429552 9:5548698-5548720 TGTATGTATCTGCATGTGTTAGG + Intronic
1050876513 9:10644939-10644961 TATTATTATCTCCATTTTGTTGG + Intergenic
1051011708 9:12423683-12423705 TGTATTTTTCTTCATGTGCTAGG + Intergenic
1052635490 9:31098328-31098350 TGTAATAATCCCCATGTGTCGGG - Intergenic
1052705514 9:31989545-31989567 TGGACTCAGCTCCATGTGGTTGG + Intergenic
1053003147 9:34588988-34589010 TGGATGTATCTCCATGTAGTGGG - Intronic
1055222382 9:73952290-73952312 TGTAATTATTTTCATGTGGTAGG - Intergenic
1057338353 9:94175995-94176017 TATAGTTATCTCCCAGTGGTGGG - Intergenic
1058530544 9:105901446-105901468 TGGCATTATGTCCATGTGCTTGG + Intergenic
1058642046 9:107097045-107097067 TGTGATTTTCTCCATCTGCTTGG - Intergenic
1059365381 9:113782809-113782831 TGTAATTATCTCCATTTTACAGG + Intergenic
1059607844 9:115855235-115855257 TGTTTTTATCTGCTTGTGGTGGG - Intergenic
1060758962 9:126232964-126232986 TGTAATTATCCCCATGTTACAGG + Intergenic
1060986689 9:127824125-127824147 TTTAATTCTCACCACGTGGTAGG + Intronic
1187783905 X:22862579-22862601 TATAATTATTTCCATATGGTAGG - Intergenic
1188604331 X:32009842-32009864 TATTTTTATCACCATGTGGTTGG - Intronic
1188746394 X:33850139-33850161 TCTTTTTATCTCCCTGTGGTAGG + Intergenic
1189348371 X:40259404-40259426 GATAATTACCTCCAAGTGGTAGG - Intergenic
1190234045 X:48602437-48602459 TGTTATTATCTCCATTTTGCAGG + Intronic
1191052587 X:56210888-56210910 TTTAATTATTTCCATCTGTTTGG + Intergenic
1192067404 X:67901246-67901268 TGTACTGATTTCCATGTGCTTGG + Intergenic
1192833415 X:74774208-74774230 TGTAATGATTTTCAAGTGGTAGG - Intronic
1193964664 X:87970740-87970762 TATAATCATCTCCATCTTGTAGG - Intergenic
1193982968 X:88207674-88207696 TGTAATTAATTGCATATGGTTGG - Intergenic
1194935453 X:99942175-99942197 TGTTAATATCTCCATATAGTGGG + Intergenic
1195137795 X:101927977-101927999 TTTAATTATCTGCATTTGGCAGG - Intronic
1195287463 X:103398818-103398840 TGTATGAATCTCCTTGTGGTAGG + Intergenic
1195902826 X:109816364-109816386 TGCAATTGTCTACATTTGGTGGG + Intergenic
1196116058 X:112000687-112000709 TGTAGGTATCTACATGTTGTAGG - Intronic
1196391041 X:115207708-115207730 TGTATTTATCTTCCTGTTGTAGG + Intronic
1196628665 X:117909483-117909505 GGAAATTTTCTCTATGTGGTTGG - Exonic
1198131043 X:133695249-133695271 TTCAATTATCTCCACCTGGTTGG + Intronic
1198629140 X:138615986-138616008 TGTAATAATCCCCATGTGTCAGG - Intergenic
1201783896 Y:17752464-17752486 TGCAAATATCTCCATGAGTTAGG + Intergenic
1201817657 Y:18153523-18153545 TGCAAATATCTCCATGAGTTAGG - Intergenic