ID: 989068870

View in Genome Browser
Species Human (GRCh38)
Location 5:37490008-37490030
Sequence AGGCTGTGGTAGGTGGGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 350}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989068858_989068870 1 Left 989068858 5:37489984-37490006 CCCCCTGATGGTCCAAATGGGTA 0: 1
1: 0
2: 1
3: 9
4: 63
Right 989068870 5:37490008-37490030 AGGCTGTGGTAGGTGGGACGGGG 0: 1
1: 0
2: 0
3: 28
4: 350
989068860_989068870 -1 Left 989068860 5:37489986-37490008 CCCTGATGGTCCAAATGGGTATA 0: 1
1: 0
2: 1
3: 4
4: 77
Right 989068870 5:37490008-37490030 AGGCTGTGGTAGGTGGGACGGGG 0: 1
1: 0
2: 0
3: 28
4: 350
989068859_989068870 0 Left 989068859 5:37489985-37490007 CCCCTGATGGTCCAAATGGGTAT 0: 1
1: 0
2: 0
3: 3
4: 72
Right 989068870 5:37490008-37490030 AGGCTGTGGTAGGTGGGACGGGG 0: 1
1: 0
2: 0
3: 28
4: 350
989068861_989068870 -2 Left 989068861 5:37489987-37490009 CCTGATGGTCCAAATGGGTATAG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 989068870 5:37490008-37490030 AGGCTGTGGTAGGTGGGACGGGG 0: 1
1: 0
2: 0
3: 28
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989068870 Original CRISPR AGGCTGTGGTAGGTGGGACG GGG Intronic
900156375 1:1204873-1204895 AGGTTGTGTCAGGTTGGACGGGG - Intronic
900329616 1:2127494-2127516 GGGCAGTGGGAGGCGGGACGTGG - Intronic
900465188 1:2822002-2822024 AGGCTGTGGAGGGAGGGACTGGG + Intergenic
900720813 1:4174684-4174706 AGGCTGTGGTTGGGAGGACTGGG + Intergenic
900978978 1:6035516-6035538 TGGATGTGGGAGGCGGGACGTGG + Intronic
901681816 1:10917197-10917219 AGGCTGTGGGAGGAGGGACAAGG + Intergenic
902441398 1:16432533-16432555 AGGCTGGGGTCTGTGGGACTAGG - Intronic
902465853 1:16618144-16618166 GGGCTGTGGGGGGTGGGTCGGGG - Intergenic
902806130 1:18862338-18862360 TGGCTGTGGTTTGTGGCACGTGG - Intronic
903988153 1:27244441-27244463 AGGCTGAGGCAGGAGGGAGGAGG - Intronic
904356587 1:29944213-29944235 AGGCTGTTGTAGGTTGAATGCGG + Intergenic
904374834 1:30073842-30073864 AGGCTGTTCTAGGTGGGGTGGGG + Intergenic
904563327 1:31413140-31413162 CGGCTTCGGTAGGTGGGGCGGGG + Intronic
905076015 1:35270688-35270710 AGGCGGTGGTAGCAGGGAGGCGG + Intronic
905647279 1:39633288-39633310 AGGCCGAGGTTGGAGGGACGGGG - Intronic
906401558 1:45508420-45508442 AGGCTGAGGAATGTGGGACCTGG - Intronic
906780688 1:48570383-48570405 GGGCTGTGAGAGGTGGGACAGGG + Intronic
906880291 1:49582341-49582363 AGGCTGTGACAGCTGGGACCAGG - Intronic
907406723 1:54258270-54258292 GGGCTCTGGTTGGTGGGAGGTGG + Intronic
908030839 1:59997667-59997689 AGGCTGAGGAATGTGAGACGTGG - Exonic
908098199 1:60762813-60762835 AGGCTGTGTGTGGTGGGAAGAGG + Intergenic
909041723 1:70661287-70661309 AGACTGTGGAAGGTGTGAGGAGG - Intergenic
910665961 1:89726196-89726218 AGGCAGTTGGAGGTGGGAGGTGG - Intronic
912725599 1:112056699-112056721 AGGCTGAGGTGGGTGGGTGGTGG + Intergenic
913103900 1:115594732-115594754 AGGCTGTGGAAGGAAGGACTGGG - Intergenic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
914720731 1:150286726-150286748 ATGCTGTAGTAGGTGGGACTGGG - Exonic
914989119 1:152482979-152483001 TGGCTGTGGCAGTTGGGAGGGGG + Intergenic
916679128 1:167088505-167088527 AGGCTGTGGTGGGAGGGATGGGG + Intronic
919658211 1:200217825-200217847 AGTCTGTGGTAGGTGTGGCAAGG - Intergenic
919690567 1:200524979-200525001 AGGTTGTGGCAGGTGGGGTGTGG - Intergenic
920397967 1:205660274-205660296 GGGCTGGGGGAGGTGGGAAGAGG - Intronic
921555501 1:216593830-216593852 AGGCTGAGGTGGGTGAGACCAGG - Intronic
923804489 1:237243466-237243488 AGGGTGAGGTATGTGGGAAGGGG + Intronic
1063163534 10:3438767-3438789 AGGCTCTGGGAGTTAGGACGTGG + Intergenic
1063464532 10:6234144-6234166 ACCCTGGGGTAGGTGGGACGGGG + Exonic
1064569868 10:16681689-16681711 AAGCTGAGGTGGGTGGGATGAGG + Intronic
1066107998 10:32172329-32172351 ATGTTGTGGGGGGTGGGACGCGG - Intergenic
1067655373 10:48187763-48187785 AGCATGTGGTAGGTGGGGTGTGG - Intronic
1069021712 10:63495669-63495691 AGGCTGAGACAGGTGGGAGGCGG + Intergenic
1070637899 10:78143858-78143880 GGCCTGTGGTAGCTGGGAAGAGG + Intergenic
1070914535 10:80144513-80144535 CGGGTGTGGCAGGTGGGGCGGGG - Intronic
1070959304 10:80487733-80487755 GGGCGGTGGTAGGGGGGAGGTGG + Intronic
1071307982 10:84315982-84316004 AGGCAGAGGTAGGGGGGAAGGGG - Intergenic
1072541653 10:96402819-96402841 AGGCTGAGGTAGGTCAGAAGAGG - Intronic
1073332006 10:102676206-102676228 AGGCAGGGGTGGGTGGGATGGGG + Exonic
1073428080 10:103468492-103468514 AGGCTGAGGCATGTGGGATGGGG - Intergenic
1073499854 10:103926582-103926604 GGGCTGCGGTAGGGGGGATGAGG + Intergenic
1075157475 10:119990027-119990049 AGGCTGTGGGAGGTGTGGGGAGG + Intergenic
1076000074 10:126906513-126906535 TGTCTGTGGATGGTGGGACGGGG - Intronic
1076176018 10:128368407-128368429 AGGCTGAGGTAGGTGGATCACGG - Intergenic
1076671437 10:132122842-132122864 AGGTTGTGGTGGGTGGCACTGGG + Intronic
1077185278 11:1232993-1233015 TGGCTGTGGTCGGTGGGGCCAGG - Exonic
1078792866 11:14562142-14562164 AGACTGTGGGAGGTGGGATGAGG + Intronic
1078917625 11:15794973-15794995 AGGCTGTGGTAGATAGTACGGGG + Intergenic
1079064319 11:17276531-17276553 AGGCTGAGCCAGGAGGGACGTGG - Intronic
1081650487 11:44820473-44820495 AGACTGTGGGAGGTGCCACGTGG + Intronic
1083747272 11:64743300-64743322 AGGCTGTGGAGGGAGGGAAGCGG - Intronic
1083832847 11:65243986-65244008 AGGCTGGGGTGGGGGGGATGGGG - Intergenic
1084131101 11:67135298-67135320 AGGCCGAGGCAGGTGGAACGAGG - Intronic
1084615320 11:70231925-70231947 AGGCTGAGTGAGGTGGGAAGGGG - Intergenic
1084971440 11:72774404-72774426 AGCCTGGGGCAGGTGGCACGGGG - Intronic
1085662444 11:78381528-78381550 TGGCTGTAGCAGGTGGGAGGAGG - Intronic
1087071360 11:94084223-94084245 AGGCTGAGGTAGGAGGTAGGAGG + Intronic
1090056655 11:123430291-123430313 AGGCAGTGGTAGGAGGGAAAGGG - Intergenic
1090061118 11:123464942-123464964 AGGGTGTGGGAGGCGGGAAGGGG + Intergenic
1090138229 11:124223209-124223231 AGCCAGTGGAAGGTGGGAGGAGG - Intergenic
1091231573 11:133991236-133991258 AGGATGTGGTGGGTGGGGTGGGG - Intergenic
1091445516 12:542514-542536 AGGTTGTGGGAGGTGGGGCCTGG - Intronic
1091577057 12:1747517-1747539 GGGCGGTGGTGGGTGGTACGTGG + Intronic
1091723084 12:2827371-2827393 AAGCTGTGGGAAGTGGGAGGGGG - Intronic
1092212080 12:6652899-6652921 GGGCTGTGAGAGGTGGGGCGAGG - Intronic
1092256529 12:6928899-6928921 GGGGTGTGGTAGGTGGAAAGAGG + Intronic
1092670263 12:10854128-10854150 TGGCTGTGGTAAGTTGGATGGGG - Intronic
1094124482 12:27008857-27008879 AGACTGAGGAAGGTGGGAGGGGG + Intronic
1094384730 12:29881796-29881818 AGTATGAGGTAGGTGGGACCAGG - Intergenic
1095709789 12:45276045-45276067 AGGATGGGGTAGATGGGACATGG - Intronic
1095722493 12:45415751-45415773 AGGCTGTGGAGGGTGTGGCGAGG - Intronic
1096137463 12:49214537-49214559 AGGCTGAGGCAGGTGGAACGAGG - Intronic
1096555850 12:52403251-52403273 GGGCTGTGGTAGCTTGGACATGG + Intronic
1096652185 12:53067275-53067297 AGGCAGGGGGAGGTGGGTCGAGG + Intronic
1098432960 12:70440528-70440550 AGGCTGAGGTGGGTGGAACACGG + Intergenic
1098577759 12:72063171-72063193 AGGTTGTCATAGGTGGGAAGTGG - Intronic
1099989851 12:89709660-89709682 AGGCTGCGGCAGGAGGGAAGGGG - Intergenic
1100825657 12:98472184-98472206 AGGCTGTGATGGGAGGGAAGAGG - Intergenic
1102878454 12:116466090-116466112 AGGCTGTGGTAGGCCAGTCGGGG - Intergenic
1103084262 12:118050096-118050118 AGGCTGAGGCAGGAGGGAAGTGG + Intronic
1103095227 12:118127024-118127046 AGGCTGTGGTGGGCTGGGCGCGG - Intronic
1103555825 12:121765908-121765930 AGGCGGTGGGAGGTGAGACTGGG + Intronic
1104845826 12:131846255-131846277 AGGCGGTGGCAGGAGGGATGTGG - Intronic
1104945892 12:132414781-132414803 AGGCTGTGGGAGCCGGGAGGAGG + Intergenic
1106215346 13:27692876-27692898 AGGTGGTGGTAGTTGGGAAGTGG + Intergenic
1107299299 13:38948347-38948369 GGGCTGTGGAAGGTGGCAGGTGG + Intergenic
1108765880 13:53628976-53628998 AGAGGGTGGTAGGTGGGAGGAGG - Intergenic
1113096466 13:106669261-106669283 AGGCGGAGGTAAATGGGACGAGG + Intergenic
1113775577 13:112943300-112943322 AGGCTGTGGTTGGGGGGTCGCGG + Intronic
1114699152 14:24659708-24659730 AGGCTGAGGCAGGTGGATCGTGG + Intergenic
1118844097 14:69533349-69533371 AAGCTGTGGTTGGTGGGCCTTGG + Intergenic
1119421036 14:74508237-74508259 AGGCTGTGGGAGGTGGGCACCGG + Intronic
1119773872 14:77236835-77236857 AGACTGTGATAGATGGGAGGGGG + Intronic
1120235838 14:81889917-81889939 AGCCAGTGGGAGGTGGGAGGTGG - Intergenic
1121114013 14:91331091-91331113 TGGCTTTGGTAAGTGGGGCGGGG + Intronic
1121613024 14:95294083-95294105 AGGGTGAGGTAGGTAGGAAGAGG - Intronic
1122827232 14:104376231-104376253 AGGATGTGGTAGGTGTGAGGCGG - Intergenic
1122973159 14:105160304-105160326 AGGCTGGGGTGGGTGGGTGGGGG - Intronic
1124274318 15:28313013-28313035 AGGCTGTGAGAGGTGGGATTTGG + Intronic
1125209451 15:37196485-37196507 AGGCTGCAGGAGGTGGGAAGGGG - Intergenic
1125297392 15:38217895-38217917 AAGAAGTGGTAGGTGGGAGGGGG - Intergenic
1125753928 15:42049551-42049573 ATGCTGTGGTAGGTATGAAGTGG + Intronic
1125971086 15:43912443-43912465 AGCCTGTGGAAGGTGGGAGTTGG - Intronic
1126341522 15:47645922-47645944 AGGCTGAGGTATGTGGGGTGAGG + Intronic
1127657831 15:61071888-61071910 AGGATGTGTTGGGTGGGACAGGG + Intronic
1128057481 15:64711196-64711218 AGGCTGTGGTAGGAATGACAGGG - Intergenic
1129518275 15:76170258-76170280 TGGGTGTGGTGGGTGGGATGAGG + Intronic
1130411659 15:83653597-83653619 AGGCTATGGGAGGTGGGGCCGGG + Intergenic
1130484902 15:84393461-84393483 AGGCTGTGGAAGGAGGCATGTGG + Intergenic
1130551270 15:84891242-84891264 AAGCTGTGGAAGGTGGGCGGGGG + Intronic
1131094052 15:89645109-89645131 AGGCTGTGGCAGGGGGGACCTGG + Exonic
1132896195 16:2230473-2230495 ATGCTGTGGGAGGTGGGGCGGGG + Intronic
1133246828 16:4454730-4454752 AGGCGGGGGTAGGTGGGCCCTGG + Intronic
1133868800 16:9668862-9668884 AGGCTGTGCTGGGTGGCAGGGGG + Intronic
1135770744 16:25216706-25216728 AGGCTGTAGAAGGTGGGAGATGG - Intronic
1136156352 16:28385025-28385047 AGGCTGAGGTGGGTGGATCGTGG + Intronic
1136206735 16:28730262-28730284 AGGCTGAGGTGGGTGGATCGTGG - Intronic
1136315853 16:29454467-29454489 AGCCTGAGGAAGGTGGGACTCGG + Exonic
1136430430 16:30193809-30193831 AGCCTGAGGAAGGTGGGACTCGG + Exonic
1136777441 16:32879404-32879426 GGGCTGGGGGAGGTGGGGCGGGG - Intergenic
1136893183 16:33982110-33982132 GGGCTGGGGGAGGTGGGGCGGGG + Intergenic
1137474624 16:48797064-48797086 AGGGTGTGGTAGGATGGAAGTGG - Intergenic
1137613326 16:49833585-49833607 AGGGGGTGGGAGGTGGGAGGGGG - Intronic
1137871896 16:51958165-51958187 AGGGTGGGGAAGGTGGGAAGAGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139453357 16:67050083-67050105 AGGCTTTGGAAGGTGGTATGTGG - Intronic
1139806112 16:69566382-69566404 AGGCTGTGGGGGGTGGGGCGTGG + Intronic
1142180051 16:88663898-88663920 AGGCTGTGGGCGGCGGGACAGGG - Intergenic
1203079854 16_KI270728v1_random:1141513-1141535 GGGCTGGGGGAGGTGGGGCGGGG - Intergenic
1143034347 17:3985921-3985943 AGGCTGGGGTAGGGAGGCCGTGG - Intergenic
1143290079 17:5821713-5821735 TGTCTGTGGTAGGTGGGGTGGGG + Intronic
1144366417 17:14549178-14549200 AGGCTGGGTTTGGTGGGATGTGG + Intergenic
1144785741 17:17830698-17830720 GGCTTGTGGGAGGTGGGACGGGG - Intronic
1145209574 17:21003313-21003335 AGGCTGTGGGAGGTTGGGTGAGG - Intronic
1145902759 17:28498906-28498928 GGGCTTTGGTGGGTGGGAGGGGG - Intronic
1146575660 17:33988980-33989002 AAGTTGTGGAAGGTGGGAGGAGG - Intronic
1146703850 17:34985421-34985443 AGGCAGTGCAAGGTGGGATGGGG - Intronic
1148144618 17:45355195-45355217 AGGATGTTGGAGGTGGGACAAGG + Intergenic
1149709332 17:58725756-58725778 AGGCTGAGGTAGGTGGATCATGG + Intronic
1151378735 17:73710240-73710262 AGGCTTTGGTGGGTGGGGTGTGG + Intergenic
1151461553 17:74257310-74257332 AGGCTGGGCTAGGTGGGACTGGG - Intronic
1152205111 17:78970470-78970492 AGACTGTGGAAGCTGGGAGGAGG - Intergenic
1152610019 17:81310809-81310831 TGGCTGTGGAAGGTGGGAAAGGG - Intergenic
1152786255 17:82249497-82249519 AGGCTGTGGAAGGGAGGCCGCGG + Exonic
1154405795 18:14090050-14090072 AGGCTATGGAAGGTGAGTCGTGG - Intronic
1156199603 18:34815006-34815028 AGTCTGAGGTAGGTAGGAGGAGG + Intronic
1156535098 18:37855143-37855165 AGGCTGGGATAGGTAGGAGGCGG - Intergenic
1157386058 18:47260829-47260851 AGGCGGAGATAGGTGGGATGGGG + Intergenic
1157436107 18:47670733-47670755 ATGGTCTGGTAGGTGGGATGGGG - Intergenic
1158045392 18:53149149-53149171 AGGCTTTGGGAGGCGGGGCGTGG - Intronic
1160333401 18:78016008-78016030 TGGCTCTGGTGGGGGGGACGTGG - Intergenic
1160739076 19:677571-677593 AGGCTGTGGGGGGGGGCACGTGG + Intronic
1160742235 19:692011-692033 AGGAGGTGGTGGGTGAGACGGGG + Intronic
1160833385 19:1113520-1113542 TGGCGGAGGTGGGTGGGACGTGG - Exonic
1161474070 19:4474688-4474710 AGGCTGGAGAAGGGGGGACGGGG - Intronic
1161621256 19:5298562-5298584 ATGCTGTGCTAGGTAGGAGGCGG - Intronic
1161636203 19:5390859-5390881 AGGGTGGGGTAGGGGGGACATGG - Intergenic
1161963791 19:7536550-7536572 AGGCTGTGCTGGGTGTGACCTGG + Intronic
1162349000 19:10137592-10137614 AGGCAGTGGTGGGTGGGCAGTGG + Intronic
1162504373 19:11074328-11074350 AGGCTGAGGCAGGGGGGAGGGGG + Intergenic
1162618344 19:11819981-11820003 AGGCTGTGGTATGAGGGTGGAGG - Intronic
1162623195 19:11861115-11861137 AGGCTGTGGTATGAGGGTGGAGG - Intronic
1162627076 19:11893395-11893417 AGGCTGTGGTATGAGGGTGGAGG - Intronic
1162631377 19:11929744-11929766 AGGCTGTGGTATGAGGGTGGAGG - Intronic
1162636221 19:11969686-11969708 AGGCTGTGGTATGAGGGTGGAGG - Intronic
1163255137 19:16151653-16151675 GGGCTGTGGGAGATGGGAGGAGG + Intronic
1163668524 19:18614084-18614106 AGGCTGTGGGAGGTGGGAGCGGG - Exonic
1164400085 19:27896263-27896285 AGGATGTGGTAGGGGGTACCAGG + Intergenic
1164593631 19:29519735-29519757 TGGCTGAGCTAGGTGGGAAGGGG - Intergenic
1165394674 19:35557870-35557892 AGGCTGTGGACGGGGGAACGGGG + Intronic
1165449462 19:35873811-35873833 AGGCTGAGATAGGTGGGAAGGGG - Intronic
1166254051 19:41589852-41589874 AGGCTGTGGTCTGGGGGAAGGGG - Intronic
1166854704 19:45777796-45777818 AGGCTGTGGGCGGTGGGCCTGGG - Exonic
1166898524 19:46040113-46040135 AGGCTGTGGGAGGGGGGAGTAGG - Intronic
925894563 2:8461362-8461384 AGGCAGTGGTAGGAGGCACCTGG + Intergenic
926394393 2:12426208-12426230 AGGCTGTGGGTGGGGGGAGGCGG + Intergenic
926650649 2:15340439-15340461 AAGATGTGGTAGGTGGGGAGAGG + Intronic
927284578 2:21343433-21343455 AGGCTCTGGCAGGTGGGGAGTGG + Intergenic
927503786 2:23600043-23600065 AGGCTAGGGTAGGAGGGAAGAGG + Intronic
929536580 2:42787930-42787952 TGGCTGGGGCAGGTGGGAGGGGG - Intronic
930656578 2:54013169-54013191 AGGATGTGGAAGCTGGGGCGGGG - Intronic
930659495 2:54039652-54039674 AGGCTGAGGTGGGTGGATCGAGG - Intronic
931215457 2:60238420-60238442 AGGCTGAGGCAGGAGGGAGGCGG - Intergenic
931267657 2:60674753-60674775 GGACTGTGGGAAGTGGGACGTGG - Intergenic
932737131 2:74262076-74262098 AGGCTGTGGCAGCTGTGACATGG - Intronic
932822956 2:74916788-74916810 AGGCTGTAGGGGGTGGGAGGAGG + Intergenic
933287711 2:80402197-80402219 AGGATGAGGTATGTGGGAAGGGG + Intronic
934694976 2:96393206-96393228 AGGCTGAGGTGAGAGGGACGTGG - Intergenic
936493378 2:112995487-112995509 AGGATGTGGGTGGTGGCACGCGG + Intergenic
937297068 2:120815861-120815883 AGGGGGTGTTAGGTGTGACGTGG + Intronic
941316323 2:163997582-163997604 AGGCTATGGTAGGGGAGAGGTGG + Intergenic
942408898 2:175685866-175685888 GTGCTGTGCTAGGTGGGACATGG - Intergenic
944499302 2:200341922-200341944 AGGCTGAGGTAGGCGGATCGTGG - Intronic
945180799 2:207089038-207089060 AGCTTGTGGTAGGAGGGAAGGGG - Intronic
946212764 2:218160882-218160904 AGGCTGTGGTTGGTCAGAAGTGG + Intergenic
946335548 2:219032908-219032930 AGGCTGAGGAGGGTGGGACCGGG + Intronic
947611012 2:231525158-231525180 AGGCTGTGGGAGCTGTGGCGGGG + Exonic
948111498 2:235459970-235459992 AGGCTTTGCTGGGTGGGAAGAGG - Intergenic
948638955 2:239360989-239361011 AGTTTCTGGGAGGTGGGACGTGG - Intronic
1168896289 20:1325906-1325928 AGTCACTGGTGGGTGGGACGCGG - Intronic
1168970879 20:1929985-1930007 AGACTGTGGGAGGAGGGAAGGGG - Intronic
1169201609 20:3712869-3712891 AGGCTGGGGGAGGTGGAAGGGGG + Intergenic
1169376505 20:5070598-5070620 GGGCTGTGGTAGGTGACAGGTGG + Intronic
1171884116 20:30639360-30639382 TGACTGTTGTAGGTGGGACCTGG - Intergenic
1172033916 20:31998914-31998936 TGGCTGTCCTAGGTGGGAGGAGG - Exonic
1172226903 20:33311238-33311260 AGGGTGTGGGTGATGGGACGCGG - Intergenic
1172539963 20:35704533-35704555 AGGTTGTGGTAAGTTGGAAGAGG + Exonic
1173813896 20:45972523-45972545 GGGCTGTTGTAGGAGGGGCGCGG - Intergenic
1174349056 20:49954087-49954109 AGGCTCTGGGAGGTGAGAAGTGG + Intergenic
1175127012 20:56760001-56760023 AGGCTGTGGGAGCTGGCACATGG - Intergenic
1175646172 20:60673783-60673805 AAGCTGTGGGAGGTTGGAAGGGG - Intergenic
1175893358 20:62325042-62325064 GGGCTGGGGTAGGTGGGAAAGGG + Intronic
1175997938 20:62819734-62819756 AGGCTCTGGGAGGAGGGAGGGGG - Intronic
1176670732 21:9732909-9732931 AGGCTGTGGCAGGAGAGAAGAGG + Intergenic
1177679147 21:24341433-24341455 GGGCTGGGGGAGGTGGGATGAGG + Intergenic
1179162418 21:38909329-38909351 AGGCTATGGGAGGTGGGAACAGG + Intergenic
1179551932 21:42148974-42148996 AGGCTGGGTTAGGCGGGGCGCGG + Intergenic
1180136387 21:45864970-45864992 AGGCTGTAGTTGGTGGGAACTGG - Intronic
1181557731 22:23681469-23681491 AGGTTGTGGTTGGTGGGCTGGGG + Intergenic
1182422714 22:30256344-30256366 AGTCTGAGGGAAGTGGGACGCGG - Intergenic
1182532066 22:30968614-30968636 AGGCTGTTGTCTGAGGGACGTGG - Intergenic
1182551908 22:31105182-31105204 AGGCCGTGGGAGGTGGGCTGGGG - Intronic
1183112543 22:35661043-35661065 AGGCTGTGGGAGGGGGTAGGGGG + Exonic
1183492419 22:38123625-38123647 AGGCTGGGGAAGGAGGGGCGGGG + Intronic
1183585781 22:38752244-38752266 AGGAAGTGGTAGGTCGGGCGCGG - Intronic
1183937045 22:41268601-41268623 TGGCTGTAGTTGGTGGGACCTGG + Intronic
1184108532 22:42382420-42382442 AGGCTGTGGGAGGTGGAGCAGGG + Exonic
1185151691 22:49167472-49167494 AGGGTGTGAAAGGTGGGAGGGGG - Intergenic
950741585 3:15056539-15056561 AGGCTGTGGTCAGAGGGAGGTGG + Intronic
952193720 3:31050566-31050588 AGGCAGTGGTAGGTGGCAGAGGG - Intergenic
953421094 3:42753882-42753904 AGGCTGTGGAAGGTGGCTGGAGG + Intronic
954238729 3:49277058-49277080 AAGCTGTGGGAAGTGGGGCGGGG - Exonic
954431200 3:50471708-50471730 GGGCTCAGGTAGGTGGGACAGGG - Intronic
954687040 3:52376699-52376721 GGGCTGGGGCAGGTGGGAAGGGG - Intronic
954798309 3:53172621-53172643 AGGCTGCAGTAGGTGGCATGGGG + Intronic
956008431 3:64805130-64805152 AGGCTATGTTGGGTGGGACTGGG - Intergenic
956114436 3:65904332-65904354 AAGATGTGGTAGGTGAGAAGGGG - Intronic
956781507 3:72606668-72606690 AGACTGGGGTAGGAGGGAGGAGG + Intergenic
956949588 3:74266335-74266357 AGGTTTTGGCAGGTGAGACGTGG - Intronic
961315727 3:126034129-126034151 AGGGTGTTGTAGGTGGCAGGGGG - Intronic
964296526 3:155239955-155239977 AGGCTGTGGTATGGGGGAGATGG + Intergenic
965740018 3:171864477-171864499 AGGGAGTGGTAGGTGGGGAGGGG + Intronic
968512877 4:1003150-1003172 CGGCTGAGGTAGGTGGGCCGCGG + Exonic
968633827 4:1667537-1667559 GGGCTGTGGGAGGTGGCATGTGG - Intronic
968869937 4:3236645-3236667 GGGCTGTGGGAGGGGGGCCGTGG + Intronic
969568235 4:7992735-7992757 AGGCAGAGGCAGGTGGGCCGCGG + Intronic
969632520 4:8346774-8346796 AGGGTGAGGTAGGTGGGGAGGGG + Intergenic
970173542 4:13313244-13313266 AGAGTGTGGAAGGTGGGAGGAGG + Intergenic
971916470 4:32876033-32876055 AATCTGTGGGAGGTGGGACCAGG - Intergenic
972687599 4:41366040-41366062 AGTCAGTGCTAGGTGGGACTAGG + Intronic
972727756 4:41760483-41760505 AGGCAGTGGAGGTTGGGACGAGG - Intergenic
973367779 4:49221633-49221655 TGACTGTTGTAGGTGGGACCTGG - Intergenic
973844782 4:54900676-54900698 AGGCTGTGGGAAGAGGGAGGTGG + Intergenic
976516530 4:85974090-85974112 AGGCTGAGGTAGGTGGATCACGG - Intronic
976801761 4:89000507-89000529 AGGATGTGGGTGGTGGGAGGAGG + Intronic
980482419 4:133404168-133404190 AGGCTGTTGGAGGTGGGGCCTGG - Intergenic
983145355 4:164207674-164207696 AGGCAGTTGTAGGGGGAACGGGG + Intronic
983428685 4:167620079-167620101 AGGCTGTAGTAGGTAGGATAAGG + Intergenic
983520791 4:168706651-168706673 AGGCTTTGGTGGGTGGGGCAGGG + Intronic
983907325 4:173197733-173197755 AGGCTGTGGTTGGAGAGAAGTGG + Intronic
985021883 4:185700345-185700367 AGGCTGTGCTGGGTGGGGGGAGG + Intronic
985404048 4:189618630-189618652 AGGCTGTGGGAGGAGAGAAGAGG - Intergenic
985489488 5:171141-171163 AGGCTGTGGGGGGCGGGCCGAGG - Intronic
986278880 5:6306376-6306398 AGCCTGTGCTGGGTGGGCCGAGG - Intergenic
989068870 5:37490008-37490030 AGGCTGTGGTAGGTGGGACGGGG + Intronic
992027181 5:72681719-72681741 AGGCTGTGGTTGCTGGGACTAGG - Intergenic
992948626 5:81834223-81834245 AGGCTGGGGAATGTAGGACGAGG + Intergenic
994831448 5:104788038-104788060 AGGCGGTGGGGGGTGGGGCGGGG + Intergenic
995138888 5:108711029-108711051 AGGCAGTGCTAGGTGGAAAGGGG + Intergenic
995456087 5:112353719-112353741 AGGCTGTGGTGGGTGGAGTGGGG + Intronic
996698132 5:126421515-126421537 GAGCTGTGCTAGGTGGGATGGGG - Intronic
997626055 5:135331199-135331221 TGGCTGTCCTAGGTGGGAAGCGG + Intronic
999242861 5:150137597-150137619 GGGCTGTGGAATGTGGGAGGTGG + Intronic
999480629 5:151944949-151944971 AGGCGGTGGTGGGTGGGGAGTGG - Intergenic
999673072 5:153974466-153974488 TGGCTGTGGTGGGTGGGAAGTGG - Intergenic
999735801 5:154512019-154512041 TGGCTGAAGTAGGTGGGGCGTGG + Intergenic
1000114348 5:158139216-158139238 ATGCTGTGGTAGGTGTGGTGGGG + Intergenic
1002175867 5:177400715-177400737 AGGCTGGGGCACGTGGGGCGTGG + Intergenic
1004662970 6:17726477-17726499 AGGCTAAGGTGGGTGGAACGAGG + Intergenic
1005154181 6:22784810-22784832 AGGCTGTGGTATGTGGAATGAGG - Intergenic
1006640266 6:35486032-35486054 GGGCTGTGGGAGGTCGCACGGGG - Intronic
1007101362 6:39249430-39249452 AGGTTGTGGAGGGTGGGACAGGG + Intergenic
1007197326 6:40074004-40074026 AAGCTGTGGCAGGTGGGGGGAGG - Intergenic
1007995637 6:46305021-46305043 AGACTGAGTTAGGTGGGACTAGG - Intronic
1010222738 6:73461869-73461891 AGGCTGTGGCCGTTGGGTCGCGG + Exonic
1012156508 6:95825761-95825783 AGAGTGTGGGAGGTGGGAGGAGG + Intergenic
1012791141 6:103697643-103697665 TGGCTGGGGTGGGTGGGAGGCGG - Intergenic
1015403218 6:132810309-132810331 AGGCTGAGGCAGGTGGGTCATGG - Intergenic
1016583724 6:145659987-145660009 AGGCTAGGGCAGGTGGGAGGTGG + Intronic
1016989611 6:149920162-149920184 GGACTGTGGGAGGTGGGACAGGG + Intronic
1017168568 6:151433945-151433967 AGGCTGAGGTGGGTGGGGCGGGG - Intronic
1017692165 6:156977871-156977893 AAGCTTTGGGAGGTGGGACAGGG + Intronic
1018916267 6:168134398-168134420 AGGCTCTGGGACGTGGGATGTGG + Intergenic
1019283278 7:211194-211216 AGGCTGAGGGAGGTTGGAGGAGG - Intronic
1019435988 7:1022329-1022351 GGGCTGTGGGACGTGGGACCAGG - Intronic
1019484416 7:1282702-1282724 GGGCTGGGGTAGGGGGGATGGGG - Intergenic
1019593518 7:1847647-1847669 AGGCTTTGGGAGATGGGCCGAGG - Exonic
1019733455 7:2639442-2639464 AGGCTGTGGGAGGCAGGAAGAGG - Intronic
1020038526 7:4982428-4982450 AGGCTGTGGTGGTAGGGAAGGGG + Intergenic
1020156779 7:5732036-5732058 AGGCTGTGGTGGTAGGGAAGCGG - Intronic
1020180409 7:5918015-5918037 AGGCTGTGGCTGGTGGAAGGCGG + Intronic
1020302522 7:6806867-6806889 AGGCTGTGGCTGGTGGAAGGCGG - Intronic
1022132428 7:27416732-27416754 AGGCTGTGGCAGGTGGCAGGCGG - Intergenic
1022474345 7:30700193-30700215 AGGCTGTGGGCTGTGGGGCGGGG - Intronic
1022593349 7:31687384-31687406 AGGCTGTAGCTGGTGGCACGGGG + Intronic
1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG + Intronic
1026730796 7:72910408-72910430 ATTCTGCGGTGGGTGGGACGGGG + Intronic
1027113293 7:75457761-75457783 ATTCTGCGGTGGGTGGGACGGGG - Intronic
1027156794 7:75774056-75774078 GAGCTGTTGTAGGTGGGAAGAGG + Intronic
1027229425 7:76263508-76263530 AAGCTGTGGGAGTTGGGAGGGGG + Intronic
1027233657 7:76285793-76285815 CGGCTGTGGTAGCTGGGACTGGG - Exonic
1027285543 7:76642356-76642378 ATTCTGCGGTGGGTGGGACGGGG - Intergenic
1029566712 7:101343361-101343383 AGGCTTTGGTGGGGGGGGCGGGG - Intergenic
1034510979 7:151534380-151534402 AGGCTGAGGCAGGAGGGAGGAGG + Intergenic
1035182224 7:157097710-157097732 AGGCGGTGGCAGGTGGCAGGTGG + Intergenic
1035589296 8:800975-800997 AGGCTGTGGACGGTGGCAGGTGG - Intergenic
1036593130 8:10186719-10186741 TGGCTGTGATGGGTGGGGCGGGG + Intronic
1036612497 8:10362500-10362522 AGGCTGTGGGTGGTGGAACTGGG + Intronic
1037291436 8:17353277-17353299 GGGCTGTGGTAGGTGGGAATGGG + Intronic
1038055413 8:23853299-23853321 AGGCTGCGGGTGGTGGGAGGGGG - Intronic
1039217514 8:35289094-35289116 AGGCTCTTGTAGGTAGGATGGGG - Intronic
1039297297 8:36170053-36170075 AGGCTATGGCAGGTGGCAGGTGG + Intergenic
1039623941 8:39028146-39028168 AGCCTGAGGGAGGTGGGAAGTGG - Intronic
1041369174 8:57142149-57142171 AGGCGGTGGGAGGTGGGCCTGGG - Intergenic
1041627600 8:60048339-60048361 AGGATATGTTGGGTGGGACGTGG - Intergenic
1042409210 8:68443069-68443091 AGCCTGTGGTTGGTGGAACATGG + Intronic
1042854051 8:73247185-73247207 AGGGTGTGGAGGGTGGGAGGTGG - Intronic
1043032461 8:75153855-75153877 AGGCTGAGGTAGCGGGGAGGAGG + Intergenic
1043579945 8:81700361-81700383 TGGCTCTGGTAGGTCGGGCGTGG - Intergenic
1045476974 8:102561391-102561413 ACGGGGTGGTAGGTGGGACGAGG + Intergenic
1045483803 8:102614351-102614373 AAGCTGTGGTGGGTGGGACTAGG - Intergenic
1045734407 8:105278105-105278127 AGGCTGAGGACGGTGGGAGGAGG + Intronic
1046655789 8:116892809-116892831 AGGCTGAGGTGGGAGGGAGGTGG - Intergenic
1047220198 8:122912461-122912483 AGGAGGTGGGAGGTGGGAGGTGG + Intronic
1048577908 8:135707310-135707332 AGGCTGGGGGAGGTGGGAGGTGG + Intergenic
1049504865 8:142990957-142990979 AGGCTGTGGGTGGTGGGTGGAGG - Intergenic
1049504918 8:142991133-142991155 AGGCTGTGGGTGGTGGGTGGAGG - Intergenic
1049504929 8:142991166-142991188 AGGCTGTGGGTGGTGGGTGGAGG - Intergenic
1049504936 8:142991186-142991208 AGGCTGTGGGTGGTGGGTGGAGG - Intergenic
1049504943 8:142991206-142991228 AGGCTGTGGGTGGTGGGTGGAGG - Intergenic
1049618101 8:143585114-143585136 AGGCTCTGGGGGTTGGGACGTGG - Intronic
1050645190 9:7712121-7712143 TGGCTGTGGTGGGTTGGACAAGG - Intergenic
1051017295 9:12494295-12494317 AGTCTGTGGTAGGTGAGGGGAGG + Intergenic
1053123868 9:35564078-35564100 GGGACGTGGGAGGTGGGACGTGG + Intergenic
1055300551 9:74877882-74877904 TGGCTGTGGTAGGAGGGGTGAGG - Intronic
1055995321 9:82151444-82151466 AAGCTTTGGTAGGTGGGAACAGG - Intergenic
1058038260 9:100276739-100276761 AGGCTGAGGTGGGTGGGTTGAGG - Intronic
1058178391 9:101766089-101766111 AGGCTGTGGCAGGTGGCAGGTGG + Intergenic
1059718378 9:116934613-116934635 AGGGAGTGGAAGGTGGGAGGGGG + Intronic
1060720456 9:125973035-125973057 AGGCTGGAGTAGGTGGGCTGAGG - Intergenic
1061062900 9:128259536-128259558 AGGCTGGGGAAGGAGGCACGAGG - Intronic
1061391687 9:130320470-130320492 GGGCCGTGGGAGGTGGGAGGTGG + Intronic
1061646131 9:132003541-132003563 AGGCAGGGATAGGTGGGATGGGG + Intronic
1203743818 Un_GL000218v1:26413-26435 AGGTGGTGGTTGGTGGGAAGGGG + Intergenic
1186223832 X:7376295-7376317 CGGCTGTGGTGGGGGAGACGTGG - Intergenic
1189380832 X:40500950-40500972 GGGCTGAGGAAGGTGGGAGGAGG + Intergenic
1189731999 X:44030847-44030869 AGGTTGTGGTAAGTTGGAAGAGG - Intergenic
1191888262 X:65912495-65912517 AGAGAGTGGTAGGTGGGAAGAGG - Intergenic
1192184630 X:68938746-68938768 AGGCTGTGGTAAGAGGGAGGGGG + Intergenic
1194433183 X:93837141-93837163 AGGGTGTGGAGGGTGGGAGGAGG - Intergenic
1195781923 X:108476559-108476581 AGGTTGTGGTAGGGAGGAGGTGG - Intronic
1195815861 X:108886740-108886762 AGGCTGTGGTAACTGGAACAGGG + Intergenic
1196918222 X:120561011-120561033 AGGCTGTGGTTGGGGGAAAGGGG + Intronic
1197507068 X:127319015-127319037 AGGCAGTGGTGGGAGGGTCGTGG + Intergenic
1197775484 X:130116219-130116241 AGGCTGAGGTAGGAGGGCTGAGG - Intergenic
1198367042 X:135951496-135951518 AGGCTGTGGCTGGTTGGACAGGG + Intergenic
1199548390 X:149032146-149032168 AGGCTATGGTAAGTGCCACGTGG - Intergenic
1200232484 X:154450984-154451006 TGGCTCTGGTGGGTGGGAAGGGG + Intergenic
1202373201 Y:24211824-24211846 AGGCTGTGGAAGGAGGCATGGGG - Intergenic
1202380920 Y:24276221-24276243 AGCCTCTGGGAGGTGGGATGTGG + Intergenic
1202489864 Y:25393904-25393926 AGCCTCTGGGAGGTGGGATGTGG - Intergenic
1202497581 Y:25458296-25458318 AGGCTGTGGAAGGAGGCATGGGG + Intergenic