ID: 989069054

View in Genome Browser
Species Human (GRCh38)
Location 5:37490993-37491015
Sequence CGTGCCATGCTGCAGGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989069046_989069054 19 Left 989069046 5:37490951-37490973 CCCAGAAAGAAAACAGACTGGTG 0: 1
1: 0
2: 1
3: 37
4: 311
Right 989069054 5:37490993-37491015 CGTGCCATGCTGCAGGTGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 229
989069047_989069054 18 Left 989069047 5:37490952-37490974 CCAGAAAGAAAACAGACTGGTGG 0: 1
1: 0
2: 0
3: 23
4: 245
Right 989069054 5:37490993-37491015 CGTGCCATGCTGCAGGTGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 229
989069045_989069054 20 Left 989069045 5:37490950-37490972 CCCCAGAAAGAAAACAGACTGGT 0: 1
1: 0
2: 6
3: 39
4: 354
Right 989069054 5:37490993-37491015 CGTGCCATGCTGCAGGTGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989069054 Original CRISPR CGTGCCATGCTGCAGGTGCT TGG Intronic
900536376 1:3179694-3179716 GGTGCCAGGATGCAGGTGCCCGG - Intronic
901196288 1:7441820-7441842 CCTACCATGCTGCAGGGCCTCGG - Intronic
902181017 1:14688386-14688408 TGTGCCAGGCAGCAGGTGCTGGG + Intronic
902886007 1:19405287-19405309 CATGGCATCCCGCAGGTGCTCGG + Intronic
903337424 1:22634478-22634500 CTTGCCATGATGCAGGTGAAGGG - Intergenic
904285895 1:29453066-29453088 CTTGCCCTGCTGCTGGGGCTGGG + Intergenic
905278501 1:36834297-36834319 AGTGCCATCCTGCAGTTGGTGGG + Intronic
906491539 1:46272579-46272601 CCAGCCATGCTTCAGGAGCTAGG - Intronic
906678911 1:47711706-47711728 GGTGCCTGGCTGCAGGTGCAGGG + Intergenic
907493587 1:54826526-54826548 GGTGCTGTGCTGCAGCTGCTTGG + Intronic
908363281 1:63390847-63390869 CATGCCATGCAGCTGCTGCTGGG + Intronic
908769051 1:67579870-67579892 CTTACCATGTGGCAGGTGCTTGG - Intergenic
909163488 1:72185090-72185112 CCTGCCATGTTCCAGGTGCCAGG - Intronic
910349430 1:86278358-86278380 CATGCCATGCAGCAGCTGCCAGG + Intergenic
911090364 1:94012654-94012676 AGAGCCAGGCTGCAGGGGCTGGG - Intronic
912166874 1:107052143-107052165 CTTGCCATTCTGCAGTTACTTGG - Intergenic
912411968 1:109485874-109485896 CGTGACAAGCTCCTGGTGCTAGG - Intronic
912436044 1:109661638-109661660 GGGGCCATGCTGCAGGAGCAGGG - Exonic
915333061 1:155125589-155125611 AGTCCCACGCTGCAGCTGCTTGG - Intergenic
915590158 1:156866249-156866271 TGTGCCAGGCTGCCGCTGCTGGG - Intronic
920128356 1:203711827-203711849 GGTGCCATGCAGCATGGGCTAGG - Intronic
922196362 1:223363658-223363680 CGTGGGATGCTGCGCGTGCTGGG + Exonic
922342055 1:224665515-224665537 CTTGCCCTGATCCAGGTGCTTGG + Intronic
922404569 1:225298678-225298700 GGTGCCATGCTGCTGTAGCTTGG + Intronic
922422780 1:225470885-225470907 CGTTCCCTGCTGCACGGGCTAGG - Intergenic
922795408 1:228337240-228337262 CCAGCCAAGCTGCAGGTGCCCGG + Exonic
924928913 1:248709850-248709872 CGTGCCATGCTGCAGCAACCTGG + Intergenic
1065880835 10:30036567-30036589 AGTGCCAGGCTGCAGCTGCCTGG - Intronic
1067040495 10:42950943-42950965 CGGGCACTGTTGCAGGTGCTGGG + Intergenic
1067141169 10:43658488-43658510 TGTGCCCAGCTTCAGGTGCTGGG + Intergenic
1070060949 10:72982049-72982071 GGTGTCATGCTGCAGAAGCTTGG + Intergenic
1075419359 10:122289182-122289204 CCTGCACTGCTCCAGGTGCTCGG + Intronic
1075747331 10:124736840-124736862 GGTGCCATGCTGCAGCTTCTAGG - Intronic
1075840540 10:125498629-125498651 CGTTGCATGCTGCAGGGGCTTGG + Intergenic
1075945134 10:126426258-126426280 CCTGCTATGCAGCAGGTTCTGGG - Intronic
1076237007 10:128871297-128871319 TGTGCCTCCCTGCAGGTGCTGGG - Intergenic
1076314866 10:129532945-129532967 CGTCCCTTCCTGCAGCTGCTCGG + Intronic
1076613607 10:131742519-131742541 TGTGCGATGCTGCAGGTGGGAGG - Intergenic
1077098361 11:809644-809666 CGTGGCATGCTGGGGGTGCTAGG + Exonic
1077214756 11:1390654-1390676 CGGGCCCCGCTGCAGGTGCGCGG + Intronic
1077270921 11:1680077-1680099 ACTGCCTTGCTGCAGGTGCGTGG - Intergenic
1078244725 11:9563666-9563688 TGTGCCATGCAGCAGCTGCTGGG + Intergenic
1078531126 11:12137378-12137400 CCTGCCTTGCTGTAGGGGCTTGG + Intronic
1080540315 11:33258076-33258098 CGGGCCACACTGCAGGGGCTAGG - Intronic
1083147497 11:60770107-60770129 GGTGCCATGATGCAGGTCCCTGG + Intronic
1083288429 11:61676015-61676037 CATCCCATCCTGCAGCTGCTGGG + Intergenic
1084039100 11:66531258-66531280 CGAGCCATACAGAAGGTGCTGGG + Intronic
1084103588 11:66966086-66966108 CGTGCCTTCCTGCCTGTGCTTGG + Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087590319 11:100178894-100178916 CGTCACTTGCTGAAGGTGCTGGG + Intronic
1088905114 11:114149463-114149485 CCTTCCATGCTGCAGGTTTTGGG - Intronic
1089135010 11:116242054-116242076 TGGGCAATGCTCCAGGTGCTAGG - Intergenic
1089296788 11:117474094-117474116 CCTGGCACACTGCAGGTGCTTGG - Intronic
1089816823 11:121183284-121183306 GGCACCATGCTGCAGCTGCTTGG + Intronic
1089955187 11:122564016-122564038 GGTGCCATGCTGCAGCGGCTTGG - Intergenic
1091321931 11:134657781-134657803 TGTTCCATGCTGGAGGTGCTGGG + Intergenic
1091369012 11:135043359-135043381 CTGGCCACGCTGCAGGTGCAGGG + Intergenic
1091594394 12:1866012-1866034 CTTGCCTTACTGCAGGGGCTGGG + Intronic
1092145941 12:6214785-6214807 AGTGCCCTGCTGCAGGTTGTGGG + Intronic
1099397548 12:82159428-82159450 TGTTCCATTCTGGAGGTGCTAGG - Intergenic
1100153551 12:91770734-91770756 CATGCCATGTTGCAGGTGGATGG + Intergenic
1100413836 12:94351371-94351393 GGTGCCATGCTGTAGCAGCTTGG - Intronic
1101068072 12:101043840-101043862 TGTGCCATGCTGCAGCTCCATGG - Intronic
1102146463 12:110658509-110658531 CCTCCAATGCTGCAGGTCCTTGG + Intronic
1103070430 12:117936806-117936828 CGTGCAATGTTCTAGGTGCTAGG - Intronic
1106463108 13:29989944-29989966 GGTGCCGTGCTGCAGCAGCTTGG + Intergenic
1107370288 13:39738008-39738030 CGCGCCATGCTGCCAGTGCCAGG + Intronic
1109075094 13:57824067-57824089 CCAGCCATGCTGCAGGTGGCAGG + Intergenic
1109971060 13:69769853-69769875 CCTGCCATTCAGCAGGTTCTGGG - Intronic
1114674944 14:24433663-24433685 CTTGCCTTGCTCAAGGTGCTAGG + Intronic
1115292130 14:31783941-31783963 CGTGTCAGTCTGCCGGTGCTAGG + Intronic
1118241290 14:64060977-64060999 CCTGCCATGCTGCTGCTGCTGGG + Intronic
1121676224 14:95755066-95755088 GGTGCCATGATGGAGGTGGTGGG + Intergenic
1122069364 14:99195650-99195672 CTTCCCATGCTGCAGGCCCTGGG - Intronic
1122203212 14:100135119-100135141 GGTGCCAGCCTGCAGGTGCTGGG - Intronic
1122290365 14:100677598-100677620 CCGGGCATGCTGCTGGTGCTGGG + Intergenic
1122744129 14:103887999-103888021 GGGGCCATCCTGCAGGAGCTTGG - Intergenic
1123491571 15:20785696-20785718 GCTGCCCTGCTGCAGCTGCTGGG - Intergenic
1123548074 15:21354790-21354812 GCTGCCCTGCTGCAGCTGCTGGG - Intergenic
1123714075 15:23013792-23013814 GGTGCCATGCTGCAACAGCTTGG - Intronic
1124594000 15:31078725-31078747 CTTTCCAGGCAGCAGGTGCTGGG - Intronic
1124692722 15:31839041-31839063 AGTGCCATGGAGCAGGGGCTGGG - Intronic
1126203431 15:46015221-46015243 GGTGCCACACTGCAGCTGCTTGG + Intergenic
1127047654 15:55043736-55043758 AGTGCCATGCTTCAGCAGCTTGG + Intergenic
1128243447 15:66117128-66117150 CCTGGCATGTGGCAGGTGCTGGG + Intronic
1128700353 15:69799491-69799513 CGTGCCAGGCTCCAGGTGGAGGG - Intergenic
1129183623 15:73892357-73892379 CTTGCCATGTTGCAGGTGACAGG + Intergenic
1129254902 15:74328738-74328760 CCTGCCATGCAGCAGGTGGGAGG + Intronic
1129320104 15:74769995-74770017 CCTGGCATGGAGCAGGTGCTCGG - Intergenic
1129825046 15:78629313-78629335 GGTGCCATGGTGTGGGTGCTGGG + Exonic
1130251832 15:82304835-82304857 AGTGTCATGCTGCAGGGGGTGGG - Intergenic
1130957965 15:88640324-88640346 CGTGCCAGGCTCCAGGTGCTGGG + Intronic
1132222281 15:100113834-100113856 CGTGCCAGGCAGGAGGCGCTGGG + Intronic
1132433501 15:101778930-101778952 AGAGCCATGCTGCATGTTCTGGG + Intergenic
1202956405 15_KI270727v1_random:82020-82042 GCTGCCCTGCTGCAGCTGCTGGG - Intergenic
1132727963 16:1346878-1346900 CAGGCCATTCTGCAGGCGCTGGG + Exonic
1133053079 16:3129567-3129589 CTGCCCATGCTGCAGGAGCTGGG + Intergenic
1133129995 16:3671085-3671107 CATGGCATGCTGCACGTGGTGGG + Intronic
1133238552 16:4401452-4401474 CCTGGCACGCAGCAGGTGCTTGG - Intronic
1135808494 16:25566117-25566139 CCTGCCATACAGCAGGGGCTTGG - Intergenic
1136043685 16:27599672-27599694 GGTGCCAGGCTGCAGGTGAGAGG - Intronic
1136088601 16:27902915-27902937 GGTGCCATGCTGCAGCTGGGAGG + Intronic
1138806939 16:60100954-60100976 CATGCCATGCAGCTGCTGCTGGG + Intergenic
1141080583 16:81048163-81048185 GGTGCCATGCTGTAGTAGCTTGG - Intergenic
1145908246 17:28528054-28528076 AGTGCCAGGCTGCAGGTGGATGG - Intronic
1147731852 17:42609185-42609207 CGGGCCCTGGTGGAGGTGCTGGG - Exonic
1148000152 17:44383108-44383130 CAGGCCGTGCAGCAGGTGCTGGG - Intronic
1148093410 17:45036080-45036102 TGTGCCGTGCTGCCGCTGCTTGG - Intronic
1149778225 17:59375155-59375177 AGAGCCATGCTTCAGGTGCATGG + Intronic
1150868605 17:68880043-68880065 GGTGCCAGGCTGCCGGTTCTAGG + Intronic
1151025119 17:70669129-70669151 CATGACATCCTGCAGGTACTGGG - Intergenic
1151390735 17:73785218-73785240 CCTACCATGTTGCAGATGCTGGG - Intergenic
1151667310 17:75552813-75552835 TGAGCCATACTGCAAGTGCTTGG + Intronic
1151787215 17:76280904-76280926 AGTGCCATCCTGCAGGTGCAGGG - Exonic
1152703844 17:81833044-81833066 CGCGCCCTCCTGCAGGTGCCGGG + Intronic
1153625200 18:7016610-7016632 CCTGCCACGCTGCAGTTGCAGGG + Exonic
1154095696 18:11413226-11413248 CAGGCCTTGCAGCAGGTGCTGGG - Intergenic
1154945514 18:21158013-21158035 CGTACCATGCTGCGGCTGCTTGG + Intergenic
1155168458 18:23249475-23249497 CTTGTCATGGTGCAGGTGCGAGG + Intronic
1156059938 18:33062733-33062755 GGTGCCATGCTTCAGCTTCTTGG - Intronic
1157181526 18:45502412-45502434 CCTGGCATGCTGTAGGTGTTTGG + Intronic
1158735534 18:60075191-60075213 GGTGCCATGCTGTAGCTGCTTGG - Intergenic
1160533384 18:79578128-79578150 TGTGCCACGCTGCAGGGGCCAGG + Intergenic
1164249000 19:23460548-23460570 AGTCCCATGATGAAGGTGCTGGG - Intergenic
1164479461 19:28600203-28600225 AGAGCCCTGTTGCAGGTGCTGGG + Intergenic
1165092735 19:33395325-33395347 CCTGGCATGCTGCGGATGCTTGG + Intronic
1165463597 19:35959144-35959166 CGTGCCTGGCTGCAGGCGCGGGG - Intergenic
1166888581 19:45975752-45975774 CTGGCCCTGCTGCAGGTGCACGG + Intergenic
1167276472 19:48543258-48543280 CCTGGCATGCAACAGGTGCTGGG + Intergenic
1167679754 19:50912132-50912154 CGAGCTCTGCGGCAGGTGCTGGG + Intergenic
926104490 2:10141839-10141861 TATGCACTGCTGCAGGTGCTGGG + Exonic
926189810 2:10720510-10720532 CGATGCCTGCTGCAGGTGCTGGG + Intergenic
928293432 2:30060562-30060584 CATGCCATGCTGCAGGGGAATGG - Intergenic
929439247 2:41952517-41952539 CGGGACATTCTGCAGATGCTGGG - Intronic
932052896 2:68416753-68416775 CCTGCCATTCAGCAGGTTCTGGG + Intergenic
934664222 2:96158617-96158639 GGCTCCATGCAGCAGGTGCTGGG + Intergenic
934766467 2:96882813-96882835 CGTGCCATGGGGCAGGAGCTGGG - Intronic
936907776 2:117556715-117556737 AGAGCCAGGCTGCAGGTGCAGGG + Intergenic
945039464 2:205731958-205731980 AGTGCCTTGCTGCAGGGACTAGG + Intronic
945823718 2:214696249-214696271 GGTGCTGTGCTGCAGTTGCTTGG - Intergenic
947337576 2:229103225-229103247 CCTACCTTGCTGCAGGTACTGGG - Intronic
947913832 2:233819387-233819409 CTTGTCATGCTGCAGGTTCATGG - Exonic
947933807 2:233985914-233985936 CATGCCAGGCTGGAGGTGCTGGG + Intronic
948369719 2:237481010-237481032 CGTGCCCTACAGCAGGTGGTGGG - Intergenic
948584955 2:239013466-239013488 CCTGCCTTGCTGCAGGGCCTGGG + Intergenic
1171539973 20:25941998-25942020 TGTGCAAAGCTGCAGTTGCTGGG + Intergenic
1171801087 20:29618324-29618346 TGTGCAAAGCTGCAGTTGCTGGG - Intergenic
1171842890 20:30237216-30237238 TGTGCAAAGCTGCAGTTGCTGGG + Intergenic
1173543058 20:43869071-43869093 TGGGCCAGGCTGCAGGTGGTCGG + Intergenic
1175251668 20:57613657-57613679 AGGGCAATGGTGCAGGTGCTCGG - Intronic
1176010172 20:62889183-62889205 GGTGCCATCCGGGAGGTGCTGGG + Intronic
1177204477 21:17995202-17995224 GGTGCCGTGCTGTAGCTGCTTGG + Intronic
1179088161 21:38238536-38238558 CGGGACATGGTGCATGTGCTGGG + Intronic
1181349332 22:22244211-22244233 AGTGCCAAGCTGCACCTGCTCGG + Intergenic
1183204685 22:36410491-36410513 CCTGCCAAGCTCCAGGTGCCCGG + Intergenic
1184115107 22:42417667-42417689 CCTGCCCTGCTGCAGGGGCAGGG + Intronic
1185346302 22:50312298-50312320 CGTGCCAGGCTGGTGGCGCTGGG + Intronic
949384824 3:3489535-3489557 GGTGCCTTGCTGTAGCTGCTAGG - Intergenic
950634855 3:14307593-14307615 CGTGTCCTGCTGCAGGTGGGAGG - Intergenic
950685913 3:14618591-14618613 TGTGCCAGGCTGCAGGTGCCAGG + Intergenic
952534371 3:34294649-34294671 TGAGCAGTGCTGCAGGTGCTGGG + Intergenic
952683983 3:36129265-36129287 CTTGCCAAGCTGCAGGTGGTGGG + Intergenic
953017524 3:39092471-39092493 CATCCCATGCTGCAGGTGCATGG - Intronic
954429934 3:50465145-50465167 GGTGCCAGGCTGCAGCTGCCCGG + Intronic
958475580 3:94576704-94576726 TGTGCCATGCTTTAGCTGCTAGG + Intergenic
958550178 3:95602150-95602172 GGTGTCATGCAGCAGGTGCAAGG - Intergenic
958644700 3:96855001-96855023 CGTTCCATTCTGGAGGTTCTAGG + Intronic
958880557 3:99664596-99664618 AGTGCCCTGTTGCAGATGCTGGG + Intronic
959952390 3:112194058-112194080 GGTGCCATGGTGCAGCAGCTTGG + Intronic
960582149 3:119289846-119289868 GGTACCATGCTGCAGCAGCTTGG + Intergenic
961060645 3:123825605-123825627 TGTGCCTTGCTGCAGCAGCTTGG - Intronic
961500364 3:127328266-127328288 CTGGACATGCTGTAGGTGCTTGG - Intergenic
962774905 3:138649961-138649983 GGCACCATGCTGCAGTTGCTTGG + Intergenic
963758229 3:149258688-149258710 GGTGCCATGCTACAGCTACTTGG - Intergenic
966674659 3:182572241-182572263 GGTGCTATGCTGCAGCAGCTTGG - Intergenic
967304494 3:188047461-188047483 TGTGCCAGGCTGCTGTTGCTTGG + Intergenic
968685985 4:1959037-1959059 TGTGGCTTGCTGCTGGTGCTTGG + Intronic
968748302 4:2372513-2372535 GGTGCCGTGCTGGAGGGGCTAGG - Intronic
969277661 4:6147782-6147804 GGTGCCCTGCAGCAGGTGATGGG - Intronic
969330163 4:6470265-6470287 CCCGGCATGCAGCAGGTGCTCGG + Intronic
969349569 4:6590670-6590692 GGTTCCAGGCTGCAGGTGCAGGG + Intronic
969401596 4:6959292-6959314 CAGGCCCTGCAGCAGGTGCTGGG + Intronic
971174801 4:24271831-24271853 CTTACCATGTTCCAGGTGCTAGG - Intergenic
974766084 4:66348505-66348527 GGTGCTATGATGCAGCTGCTTGG - Intergenic
975365697 4:73524940-73524962 TGTGCCATGCAGCCGCTGCTAGG + Intergenic
975920349 4:79379705-79379727 GGTGTCATGTTGCAGCTGCTTGG - Intergenic
976095920 4:81508098-81508120 TGTGCCATGCACAAGGTGCTAGG + Intronic
976777585 4:88722965-88722987 CGTGTTATGCTGCAGCTGCCCGG - Intergenic
977615649 4:99085187-99085209 AGTGCAAGGCTGCAGTTGCTTGG - Exonic
980108816 4:128615010-128615032 GGTGCCATGTGGCAGTTGCTTGG - Intergenic
980126091 4:128775749-128775771 GGTTCTATTCTGCAGGTGCTGGG - Intergenic
980686710 4:136239477-136239499 TGTTCCATGCTGCAGCTTCTGGG - Intergenic
981360466 4:143839995-143840017 AGTGCCACGCTGCAGCAGCTTGG + Intergenic
981371239 4:143961060-143961082 AGTGCCACGCTGCAGCAGCTTGG + Intergenic
981751077 4:148092764-148092786 CGTGCCATGCCAGGGGTGCTAGG + Intronic
985751595 5:1681794-1681816 AGTGCTGTGCTGCAGCTGCTTGG + Intergenic
985948098 5:3202231-3202253 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948110 5:3202295-3202317 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948122 5:3202359-3202381 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948134 5:3202423-3202445 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948145 5:3202487-3202509 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948157 5:3202551-3202573 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
988340022 5:29959441-29959463 TGTGCCATGATGCCAGTGCTGGG - Intergenic
989069054 5:37490993-37491015 CGTGCCATGCTGCAGGTGCTTGG + Intronic
990734158 5:58841511-58841533 GGTGCTATGCTGCAGAAGCTTGG + Intronic
1001146766 5:169191845-169191867 CCTGACATGCTGCAGCAGCTGGG + Intronic
1004811486 6:19268910-19268932 GGTGTCATGCTGCAGCAGCTGGG - Intergenic
1005592946 6:27347938-27347960 AGTACCATGCTGCAACTGCTTGG - Intergenic
1009603734 6:65838013-65838035 AGTGCAAGGCTGCAGTTGCTTGG - Intergenic
1009670914 6:66748593-66748615 GGCGCCATGCTGCAGAAGCTTGG + Intergenic
1012305461 6:97651396-97651418 CTTGCCATGTTGCAGAGGCTGGG + Intergenic
1012615169 6:101268827-101268849 GGTGCCATGCTGCAGCAGCTTGG - Intergenic
1017243565 6:152197111-152197133 CGTGCCATGTGGCTGCTGCTGGG + Intronic
1017705382 6:157117937-157117959 AGTGCCAGGCTCCAGGTGCAAGG - Intronic
1018969355 6:168515562-168515584 CGAGCCAGGATGCAGGTGCGAGG - Intronic
1020093589 7:5355210-5355232 CCTGCCAGGCAGCAGGTTCTGGG + Intronic
1020188500 7:5976383-5976405 CCCGCCCTGCTCCAGGTGCTCGG - Intronic
1020294415 7:6748387-6748409 CCCGCCCTGCTCCAGGTGCTCGG + Intergenic
1021831660 7:24618472-24618494 GGTGACATGCTGCAGCAGCTTGG + Intronic
1022872719 7:34496131-34496153 GGTGCCATGCTGCAGGGGTTGGG - Intergenic
1023220449 7:37916388-37916410 CGTGCTGTGGTGCAGGTGGTTGG + Exonic
1023850755 7:44149007-44149029 CAAGCCAAGCTGCAGCTGCTGGG - Intronic
1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG + Intronic
1025291409 7:57728232-57728254 TGTGCAAAGCTGCAGTTGCTGGG + Intergenic
1026848100 7:73708794-73708816 CGGGCCAGGCTCCGGGTGCTGGG + Intronic
1029131437 7:98334502-98334524 TGTGCCAGGCTGCAGATTCTGGG - Intronic
1030605386 7:111633875-111633897 GGTGTCATGCTGCAGCTGCCTGG + Intergenic
1032711317 7:134462965-134462987 GGCGCCATGCTGCAGCAGCTTGG - Intergenic
1034064645 7:148124508-148124530 CCTGCCCTACTGCTGGTGCTGGG + Intronic
1035182227 7:157097728-157097750 GGTGGCAGGCAGCAGGTGCTAGG + Intergenic
1036096791 8:5733520-5733542 CGTGCAAGGCTGCTGGGGCTTGG + Intergenic
1036421518 8:8600377-8600399 CGGGCCATGCTTCAGGCGTTGGG - Intergenic
1036652320 8:10653057-10653079 TGTGGCTTGCTGGAGGTGCTGGG - Intronic
1038493781 8:27987789-27987811 GGTGCCATCCTCCAGGTCCTTGG + Intronic
1039038942 8:33388698-33388720 GATCCCGTGCTGCAGGTGCTGGG - Intronic
1040560256 8:48517448-48517470 CTTGCCTGGCTGCAGGTGCAGGG + Intergenic
1044724728 8:95184018-95184040 CGTGCGAGGCTGCAGGTGTGTGG + Intergenic
1049201368 8:141342121-141342143 CGTGCCCTGCTGCAGGGCCTTGG + Intergenic
1050607346 9:7315320-7315342 GGTGCTGTGCTGCAGCTGCTTGG + Intergenic
1051334481 9:16054001-16054023 CAGGCCAGGCTGCAGGTTCTGGG - Intronic
1055681913 9:78724393-78724415 GGTACCATGCTGCAGCAGCTTGG - Intergenic
1057320011 9:94004069-94004091 ACTCCTATGCTGCAGGTGCTGGG - Intergenic
1059529487 9:115022950-115022972 CCTGACATGCAGCAGGTGTTGGG - Intronic
1061060516 9:128247963-128247985 GGTGCCAGGCTGCAGATGCCTGG - Intronic
1061801853 9:133117066-133117088 AGTGCCATGCTGAAGGTGCCAGG + Intronic
1188168453 X:26892185-26892207 GGCTCCATGCTGCAGATGCTTGG - Intergenic
1188917987 X:35935419-35935441 CATGCCATGCTGCCACTGCTGGG + Intronic
1189888885 X:45577867-45577889 GGAGCCTTGCTGCAGCTGCTTGG + Intergenic
1193108303 X:77703380-77703402 CGTGCCCTGCTGCAGCTGCCAGG - Intronic
1194518432 X:94888231-94888253 GGTGCCATACTGCAGCAGCTAGG + Intergenic
1196013686 X:110915129-110915151 CATGCCATGTGGCAGGTGGTGGG + Intergenic
1199489957 X:148387311-148387333 GGTGCCATGCTGGAGCTTCTTGG - Intergenic
1200301359 X:154979803-154979825 GGTGCTGTGCTGCAGCTGCTTGG + Intronic