ID: 989077197 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:37576121-37576143 |
| Sequence | GAGGGGGGAAGGAGGGCGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 6567 | |||
| Summary | {0: 1, 1: 1, 2: 70, 3: 802, 4: 5693} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 989077197_989077210 | 0 | Left | 989077197 | 5:37576121-37576143 | CCCTCCGCCCTCCTTCCCCCCTC | 0: 1 1: 1 2: 70 3: 802 4: 5693 |
||
| Right | 989077210 | 5:37576144-37576166 | CCTCCCTCCCTAAAATCCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 989077197 | Original CRISPR | GAGGGGGGAAGGAGGGCGGA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||