ID: 989077197

View in Genome Browser
Species Human (GRCh38)
Location 5:37576121-37576143
Sequence GAGGGGGGAAGGAGGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6567
Summary {0: 1, 1: 1, 2: 70, 3: 802, 4: 5693}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989077197_989077210 0 Left 989077197 5:37576121-37576143 CCCTCCGCCCTCCTTCCCCCCTC 0: 1
1: 1
2: 70
3: 802
4: 5693
Right 989077210 5:37576144-37576166 CCTCCCTCCCTAAAATCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989077197 Original CRISPR GAGGGGGGAAGGAGGGCGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr