ID: 989078022

View in Genome Browser
Species Human (GRCh38)
Location 5:37585785-37585807
Sequence GAGATTATGACAGGCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989078022_989078030 14 Left 989078022 5:37585785-37585807 CCTGCCCTGCCTGTCATAATCTC 0: 1
1: 0
2: 0
3: 21
4: 245
Right 989078030 5:37585822-37585844 TGTTATCTGTTGCCTTTCCAAGG 0: 1
1: 1
2: 3
3: 17
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989078022 Original CRISPR GAGATTATGACAGGCAGGGC AGG (reversed) Intronic
900641609 1:3690381-3690403 GAGATCATGGTAGGCAAGGCTGG - Intronic
901787215 1:11632645-11632667 GAGATGAAGACAGTGAGGGCAGG + Intergenic
902268936 1:15289351-15289373 GAGGTTATGACCGGCTGGGATGG - Intronic
902755465 1:18546473-18546495 GAGACTGGGACAGACAGGGCAGG + Intergenic
904538757 1:31218753-31218775 TCGACTATGACAGGCTGGGCTGG - Intronic
905210567 1:36371256-36371278 GAAATAATGACAAGAAGGGCCGG + Intronic
905452483 1:38065548-38065570 CAGCTTCTGACAGGCAGAGCTGG - Intergenic
905805536 1:40874287-40874309 GAGATTAGGAAAGGCAGGAGGGG + Intergenic
907247348 1:53116623-53116645 GAGATTATCCCACGCAGGGCCGG + Intronic
908056025 1:60288073-60288095 GACATTCTGAGAGGCAGTGCAGG - Intergenic
910360504 1:86410528-86410550 GCGTTTATGACAGGTGGGGCTGG - Intergenic
916398387 1:164417474-164417496 GTGATTGGGACTGGCAGGGCTGG - Intergenic
916809546 1:168293340-168293362 GAGATCATGGCAGGATGGGCGGG + Intronic
921362245 1:214340925-214340947 GAGATAAAGGCAGGAAGGGCTGG - Intergenic
922282607 1:224140651-224140673 GAGAATATAGCAGGCCGGGCAGG + Intronic
923014302 1:230114030-230114052 GAGACTCTGACAGCCAAGGCTGG - Intronic
1064721477 10:18234041-18234063 GATACTGGGACAGGCAGGGCTGG + Intronic
1064811850 10:19208752-19208774 GTGATTCTAACAGGCAGGGCTGG - Intronic
1066598662 10:37079972-37079994 GTGAATATGACAGGCTGGGTTGG + Intergenic
1067438052 10:46292619-46292641 GAGATTAGCTCAGGGAGGGCTGG + Intronic
1067574856 10:47402756-47402778 GAGGTTAGCTCAGGCAGGGCTGG + Intergenic
1067786997 10:49257657-49257679 GATGTTATGACTGGCAGGGCCGG - Intergenic
1068739656 10:60454421-60454443 GAGATTCTAAGAGGCTGGGCTGG - Intronic
1068743726 10:60504316-60504338 CAGTTTATGACAGGCATGGTAGG + Intronic
1070055528 10:72930809-72930831 GTTATTTTGGCAGGCAGGGCGGG - Intronic
1070838175 10:79464461-79464483 GATAGTAACACAGGCAGGGCAGG - Intergenic
1072886137 10:99275882-99275904 GAGATTATTACATGAAGGGGTGG + Intergenic
1073345961 10:102783122-102783144 GAGGTTAGGACAGGCTGGGGCGG + Intronic
1074915593 10:117951838-117951860 GAGGTGAAGAAAGGCAGGGCAGG - Intergenic
1075571751 10:123551428-123551450 GAGAGCATGCCAGGCAGGGATGG + Intergenic
1078389157 11:10920978-10921000 CAGATTTTGATAGACAGGGCTGG + Intergenic
1078677326 11:13434559-13434581 AAGATTATGACAGGCATTGAAGG + Intronic
1080167911 11:29261976-29261998 GAGAATATCACAGGCAGGTGGGG + Intergenic
1082999669 11:59279963-59279985 CAGTTTATGACAGGCAGTTCAGG - Intergenic
1084576309 11:69990150-69990172 GGGGTTAGGAGAGGCAGGGCGGG - Intergenic
1085018520 11:73190761-73190783 GAGGTTGTGACAGGAAGAGCAGG + Intergenic
1085529862 11:77184792-77184814 GAGATTAAGCCAAGCAGGCCTGG + Intronic
1086391699 11:86371592-86371614 GAGTTTAATACAGGCAGAGCTGG - Intergenic
1089393602 11:118118694-118118716 CTGATTATCACAGGCAGGGAGGG - Exonic
1090027709 11:123181896-123181918 GAGGGAATGACAGGCAGGCCTGG - Intronic
1090662926 11:128894722-128894744 GACATTCTGCCAGCCAGGGCTGG + Intronic
1091601618 12:1921345-1921367 TAGATGATGAGAGGCAGGGTGGG - Intergenic
1091774387 12:3174966-3174988 GAAAAGAAGACAGGCAGGGCAGG - Intronic
1091856159 12:3742068-3742090 GAGGTTAGGACAGGGAGGGCTGG + Intronic
1092450514 12:8597441-8597463 GATATTATCTCAGGGAGGGCAGG + Intergenic
1092874509 12:12836333-12836355 GAGATTCTGTGAGGCAGGCCAGG - Intergenic
1094479339 12:30869389-30869411 GAGATGAAGCCAGGCTGGGCTGG - Intergenic
1095212232 12:39507741-39507763 CAGCCTATGACAGGCAGGTCAGG + Intergenic
1095264614 12:40139763-40139785 GAGAATATGAAAGGAAGGACAGG + Intergenic
1095802281 12:46281541-46281563 GTCAGTATGACAGGCAGGACAGG - Intergenic
1098009974 12:66040569-66040591 GAGAGCATTTCAGGCAGGGCAGG + Intergenic
1098667792 12:73185817-73185839 GAGATTATGCAAGGCAGGTCTGG + Intergenic
1099220647 12:79909989-79910011 AATAATATGACAGGCTGGGCGGG - Intronic
1101433517 12:104645903-104645925 TTGATCATGACAGGCAGAGCTGG - Intronic
1101471694 12:105002860-105002882 GTGGTTATGGCAGGCAGGCCTGG + Intronic
1102031088 12:109740532-109740554 GGGATGATGCCAGGCAGGGAGGG + Intronic
1107049744 13:36034434-36034456 GAGATCATCACAGGGAGAGCTGG - Intronic
1110646694 13:77893939-77893961 GGGGTTGTGAGAGGCAGGGCTGG - Intergenic
1111867209 13:93784141-93784163 GAGATAATCAGAGGCAGGGTGGG + Intronic
1114479257 14:23021729-23021751 GAGATATTGACAGGCAGAGCTGG - Intronic
1118874010 14:69767482-69767504 GACATTAAGACTGGCAGGGACGG - Intronic
1119592931 14:75907118-75907140 CAGATTATGGGAGGCAGGGAGGG + Intronic
1120484419 14:85093455-85093477 TAGATTTTGTCAGGCAGGGGTGG - Intergenic
1120763034 14:88303150-88303172 GTGATCAAGAGAGGCAGGGCAGG + Intronic
1121562654 14:94886528-94886550 CAGAGCATGAGAGGCAGGGCTGG - Intergenic
1121930339 14:97966460-97966482 GAGGTTAAGAAAGCCAGGGCAGG - Intronic
1122248975 14:100424896-100424918 GATATTATGCCAGGAGGGGCAGG - Intronic
1122937300 14:104966158-104966180 GAGGTGAGGGCAGGCAGGGCTGG + Intronic
1125769412 15:42154882-42154904 GAGGTGAGGGCAGGCAGGGCTGG - Intronic
1126141807 15:45445333-45445355 GAGGTTATCACAGGCAGGCCTGG - Intronic
1128513526 15:68327861-68327883 GTGATCATGACAGGGAGGACAGG - Intronic
1128644087 15:69362131-69362153 GAGATTCTGAATGTCAGGGCTGG + Intronic
1128698708 15:69788371-69788393 GGCACTATGACAGGCAGGGGTGG - Intergenic
1129385493 15:75193987-75194009 CAGATGATGGCAGGCAGGGAGGG - Intergenic
1129710964 15:77820017-77820039 GAGAATGTGAGAGGCAGCGCAGG - Intronic
1129963361 15:79710260-79710282 GTGATGATGACAGGCAGGTTAGG + Intergenic
1130706976 15:86242567-86242589 CAGATTAGGACATGCAAGGCAGG + Intronic
1131346949 15:91658591-91658613 GAAATGAAGACAGGCAGAGCTGG - Intergenic
1131658368 15:94485493-94485515 GTGGTTGTGACAGGCTGGGCAGG - Intergenic
1131791734 15:95972813-95972835 GAGGTTATGGCAGGAAAGGCAGG + Intergenic
1132222124 15:100112811-100112833 GAGGTGGTCACAGGCAGGGCAGG + Intronic
1133862057 16:9605311-9605333 GGGAGTATGAGAGGCAGGGGAGG - Intergenic
1133911668 16:10071751-10071773 GTGATAGTGGCAGGCAGGGCTGG - Intronic
1134312122 16:13084468-13084490 GTGAGAATGACAGACAGGGCTGG + Intronic
1135468352 16:22706756-22706778 GATATGATGGCAGGTAGGGCTGG + Intergenic
1137666319 16:50251750-50251772 GGGACAATGACAGGCAAGGCTGG - Intronic
1137747576 16:50834453-50834475 TAGCTTAGGACAGGCAGGACAGG + Intergenic
1138148166 16:54630943-54630965 TAGATAAAGAAAGGCAGGGCTGG + Intergenic
1138868392 16:60850867-60850889 CAGTTTATGACAGGCAGTTCAGG - Intergenic
1139364547 16:66425833-66425855 GACGTGATGACTGGCAGGGCTGG + Intergenic
1140477368 16:75245578-75245600 GAGCTCATGCCTGGCAGGGCTGG - Intronic
1144572508 17:16408245-16408267 GAAATTATCTCAGGCTGGGCAGG + Intergenic
1145992876 17:29089786-29089808 GAGAGCAGGCCAGGCAGGGCGGG + Intronic
1147365788 17:39958293-39958315 GGGATGAAGACAGGCTGGGCTGG - Intergenic
1147460611 17:40565686-40565708 TAGATTCTGCCAGGCAGCGCAGG - Intergenic
1150125048 17:62629857-62629879 AGGCTTATGCCAGGCAGGGCAGG + Intronic
1150996220 17:70320788-70320810 GAGAGTATGACAGCAAGGGGTGG + Intergenic
1151659227 17:75509884-75509906 GACAATGTGACAGGCAGGACAGG + Intronic
1155042596 18:22077439-22077461 GGGATTATGACAGGCAGCTTTGG - Intergenic
1155365404 18:25044316-25044338 GAGCTTAGGTCAGGCTGGGCAGG + Intergenic
1159104037 18:63985342-63985364 GGGGTTATTACAGGCAGTGCTGG + Intronic
1159819562 18:73122880-73122902 GATATTATGAAAGGGAGGGCTGG + Intergenic
1159984954 18:74830929-74830951 GAGGATATGACAGGCTGGGAAGG - Intronic
1160406906 18:78652621-78652643 TAGATGAGGACAGGCAGGCCAGG + Intergenic
1161351019 19:3791730-3791752 CAGATTATGACAGCCAGAGGGGG - Intronic
1163318078 19:16555127-16555149 GAGAGTCTGAGAGGCTGGGCAGG - Intronic
1163725659 19:18921812-18921834 CAGAGCATGAGAGGCAGGGCTGG - Intronic
1165865574 19:38935089-38935111 GAGATGCTGACAGGCAGTGCTGG + Intronic
1165996688 19:39848683-39848705 GAGACACTGGCAGGCAGGGCAGG + Intergenic
1166287165 19:41838344-41838366 CAGATTGTGACAGGCAGGGTGGG - Intronic
1167247755 19:48383985-48384007 GAGCGTAGGCCAGGCAGGGCAGG - Intronic
925146641 2:1587118-1587140 GAGATGACCACAGGGAGGGCCGG - Intergenic
925941656 2:8826315-8826337 GAAAGTATTTCAGGCAGGGCGGG + Intronic
926041602 2:9677762-9677784 GAGATTATAACAGCCAGGTGCGG - Intergenic
926041810 2:9679647-9679669 GGGCTTGTGGCAGGCAGGGCTGG - Intergenic
927561392 2:24076653-24076675 AGGGTTATGACAGGTAGGGCGGG + Intronic
928351285 2:30557747-30557769 GAGATTATGACTGGTAGAGTAGG + Intronic
929052667 2:37851243-37851265 GAGAGTATAACAGGCAGGCTTGG - Intergenic
930014376 2:46960318-46960340 GGGATTCTGACAGGCAGGGGAGG - Intronic
930090393 2:47527540-47527562 AAGAGTAGGTCAGGCAGGGCAGG - Intronic
930656706 2:54014187-54014209 AAAATTAAGGCAGGCAGGGCAGG + Intronic
932428553 2:71659291-71659313 GAGATTTTGATAGGCTGGGAGGG + Intronic
933239637 2:79905690-79905712 GAGGTGAGGACAGGCAGAGCTGG + Intronic
933804537 2:85988593-85988615 GCGATTAAGACCTGCAGGGCTGG - Intergenic
935586001 2:104800928-104800950 GAGATTCTGGAAGGCAGGGCAGG - Intergenic
937775509 2:125770901-125770923 GAGATTAAGAGAGGCAGCTCAGG + Intergenic
938175018 2:129117896-129117918 CAATATATGACAGGCAGGGCAGG - Intergenic
938652890 2:133401949-133401971 GAGATCATGACAGGCAAGCTTGG - Intronic
938920894 2:135993606-135993628 GTGATTATTATGGGCAGGGCTGG + Intergenic
940697085 2:156993206-156993228 GAGTTTATTACAGGCAGGAGAGG + Intergenic
943304148 2:186239036-186239058 GTGATTATGACAGTGAGGGTGGG + Intergenic
944863783 2:203840732-203840754 GAGATGATGGCAGCCAGAGCTGG + Intergenic
946790020 2:223291783-223291805 GAGATTTTGTAAGGCAGGCCTGG + Intergenic
947010566 2:225561576-225561598 GGGATAAAGACAGGCAGGGCTGG + Intronic
947182458 2:227423600-227423622 TAGAGAATGACAGGCAGGGGTGG + Intergenic
948730575 2:239961373-239961395 AAGCTTCTGGCAGGCAGGGCTGG - Intronic
1169065303 20:2691828-2691850 GTGAACATGGCAGGCAGGGCAGG + Intergenic
1170131848 20:13029138-13029160 TAGCTTATGACAGGAGGGGCTGG + Intronic
1172971974 20:38880368-38880390 CAGAGAAAGACAGGCAGGGCTGG + Intronic
1173824690 20:46040692-46040714 GAGATTCTGAGGGGCAGGGAGGG - Intronic
1173948631 20:46972469-46972491 CAGCTAATGACAGGCAGAGCCGG - Intronic
1174037209 20:47675658-47675680 CAGCCTTTGACAGGCAGGGCAGG + Intronic
1180958938 22:19754058-19754080 GAGATGATGAGAGGGATGGCTGG - Intergenic
1180998017 22:19975111-19975133 GGGAGTATTACAGGCAGAGCAGG - Intronic
1181000158 22:19984319-19984341 GAGGGTCTGACAGGCAGAGCTGG + Intronic
1181015182 22:20064476-20064498 GTGGCTGTGACAGGCAGGGCAGG + Intronic
1181270981 22:21658236-21658258 AAGAGTAGGAGAGGCAGGGCAGG - Intronic
1181402557 22:22660128-22660150 GAGATGCTGACATGCAGGGAGGG + Intergenic
1181417385 22:22770428-22770450 GAGATGCTGACATGCAGGGAGGG + Intronic
1181420576 22:22795190-22795212 AAGATTATGACACAAAGGGCTGG - Intronic
1181423446 22:22817705-22817727 GAGATGCTGACATGCAGGGAGGG + Intronic
1181430648 22:22879615-22879637 GAGATGCTGACATGCAGGGAGGG + Intronic
1182022670 22:27094251-27094273 GTGACTGTGGCAGGCAGGGCCGG + Intergenic
1182045003 22:27267409-27267431 GACATTAAGAAAGCCAGGGCAGG + Intergenic
1183172481 22:36198536-36198558 GTGCTTGTGACAGGCAGTGCAGG + Intronic
1184615227 22:45633388-45633410 GGGATGAAGACAGGCAGGGCTGG + Intergenic
1184646460 22:45897912-45897934 GAGTTAGTGCCAGGCAGGGCAGG + Intergenic
949973865 3:9436151-9436173 GGGATTGTGCCAGGTAGGGCTGG - Intronic
951194084 3:19804413-19804435 GGGAGCAAGACAGGCAGGGCTGG - Intergenic
951596150 3:24320405-24320427 GACATTATGGCATTCAGGGCAGG + Intronic
953914188 3:46907388-46907410 GCGTTTTTAACAGGCAGGGCAGG + Intergenic
957527262 3:81393072-81393094 GCAATTATGAAAGGCAGGGAGGG - Intergenic
957629885 3:82705573-82705595 GAGCTTTTGCCAGGCAGGCCTGG + Intergenic
958807984 3:98834871-98834893 GGGATTATGACAGGCAGCTTTGG - Intronic
958898851 3:99861769-99861791 AAAACTATGAGAGGCAGGGCAGG + Intronic
958913649 3:100023776-100023798 GAGAGTAAGACATGCAGAGCAGG - Intronic
959104089 3:102046509-102046531 AAGATTCTGACAGACAGGACAGG - Intergenic
959132677 3:102377169-102377191 GTGGTTATCACAGGAAGGGCAGG + Intronic
959512172 3:107226070-107226092 GAGATAATAACAGGAAGGTCTGG - Intergenic
961131024 3:124467521-124467543 GGGATTTTTACAGGCAGGGATGG + Intronic
961489527 3:127244780-127244802 CAGATTCTGATAGGCAGGTCTGG - Intergenic
961703525 3:128765712-128765734 GTGATTAAGTCAGGAAGGGCAGG - Intronic
963171087 3:142251934-142251956 GACAGTATGGCAGGCAGGGAGGG + Intergenic
963867434 3:150377979-150378001 GAGATTGTGACAGGCCTGGGAGG - Intergenic
965682283 3:171263846-171263868 GAGGTTATGGAGGGCAGGGCGGG + Intronic
966437839 3:179908417-179908439 GAGTTTATAAAAGGCAGAGCTGG - Intronic
966902092 3:184493896-184493918 GAGATCATGAAAACCAGGGCAGG - Intronic
966924066 3:184633313-184633335 GGGAGGGTGACAGGCAGGGCAGG - Intronic
968381985 4:104265-104287 GAGATTATTATAAGCAGGACTGG - Intergenic
970692084 4:18631293-18631315 TAGATTCTGAAAGGCAGGGTTGG - Intergenic
974291489 4:59937459-59937481 GAGATGATGAAAGACAAGGCAGG - Intergenic
975568998 4:75792837-75792859 GTGGTTATCAGAGGCAGGGCAGG - Intronic
977536785 4:98262601-98262623 GAAATTATGACAGACAGGAGTGG - Intronic
977617347 4:99101452-99101474 GAGGTTATTAGAAGCAGGGCAGG - Intergenic
977760738 4:100733630-100733652 GAAATTAGGACAGGCAAGGAAGG + Intronic
978624127 4:110665214-110665236 GAAGTGATGCCAGGCAGGGCAGG - Intergenic
982597769 4:157406944-157406966 CAGTTTATGACAGGCAGTTCAGG + Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985510620 5:311332-311354 GAAAGTTTGACAGGCAGGGACGG + Exonic
985966380 5:3341703-3341725 GCTGTTAAGACAGGCAGGGCTGG - Intergenic
986273513 5:6254022-6254044 GAGGATATGAAAGCCAGGGCAGG - Intergenic
987332618 5:16870464-16870486 CAGATTCTGACAGGCAGGTTGGG - Intronic
987844150 5:23259774-23259796 GTGATTATAACAGGCAAGACTGG + Intergenic
988310213 5:29547879-29547901 GAGATTTTGGCAGGCAAGGGTGG - Intergenic
989078022 5:37585785-37585807 GAGATTATGACAGGCAGGGCAGG - Intronic
990875178 5:60476424-60476446 GAGGCTATGACAGTCATGGCAGG - Intronic
991330729 5:65489601-65489623 GAGTTTATGACAGGCAGTTTAGG + Intergenic
993013849 5:82513573-82513595 GAAATTAAGAATGGCAGGGCAGG + Intergenic
995321559 5:110840386-110840408 AAGATTATGTGAGGCAGGACAGG - Intergenic
995660641 5:114478866-114478888 GAGATCTTGAAAGGCAGGCCTGG - Intronic
1001485198 5:172115016-172115038 GCGATTCTCACAGGCTGGGCAGG + Intronic
1003046460 6:2737611-2737633 CAGAATATGACAGGGAGGGAGGG + Intronic
1003294409 6:4811715-4811737 GAGCTTTGGAAAGGCAGGGCAGG - Intronic
1004293494 6:14389443-14389465 GAGTTTAAGACAGGTAGAGCTGG + Intergenic
1004425504 6:15504351-15504373 GAGTTAATGACAGGCAGAGAAGG - Intronic
1005020478 6:21413276-21413298 GAAATTTTCACAGGCAGGCCTGG + Intergenic
1007228321 6:40330200-40330222 CAGATCTTGACAGGCTGGGCTGG - Intergenic
1007339377 6:41180864-41180886 GAGACTAAGCCAGGCAGGGCAGG + Intergenic
1007808686 6:44470971-44470993 GACATGACAACAGGCAGGGCAGG - Intergenic
1008285727 6:49647314-49647336 GGGATTATAACAAGCAGGGAAGG + Intergenic
1009549788 6:65074376-65074398 AAGATTATGCCATGAAGGGCAGG - Intronic
1010606058 6:77890645-77890667 GAGATTATGAGGGGCTGGGGTGG + Intronic
1010984149 6:82403009-82403031 CTGATTATTCCAGGCAGGGCTGG + Intergenic
1012961079 6:105622434-105622456 GAGATTTTGCTAAGCAGGGCAGG + Intergenic
1013671650 6:112409468-112409490 GAGATGATGTCAGGCACAGCAGG - Intergenic
1014041774 6:116835511-116835533 GAGACAATGAAAGGCAGAGCTGG - Intergenic
1014611270 6:123550272-123550294 GAGAGAGTGACAGGCAGAGCAGG + Intronic
1015515147 6:134075892-134075914 GAGATTTTGAGAGTCAGAGCAGG - Intergenic
1016926938 6:149360624-149360646 GAGATTTTGAGAGGCAGGGGCGG - Intronic
1017434549 6:154404001-154404023 AAGAGTAAAACAGGCAGGGCTGG + Exonic
1017571615 6:155750509-155750531 GAGATTTTGTAAGGCAGGCCTGG - Intergenic
1017884675 6:158588905-158588927 GACATTCCGAAAGGCAGGGCCGG + Intronic
1018082169 6:160268426-160268448 GAGATGAAGACACGAAGGGCTGG + Intronic
1018363154 6:163093102-163093124 GAGATTATGCCAGGAAAGGATGG - Intronic
1019362085 7:610036-610058 TAGAGAATGCCAGGCAGGGCGGG - Intronic
1019603540 7:1897347-1897369 GAGATGAGGACAGGCAGAGACGG - Intronic
1021112746 7:16714190-16714212 GAGACTACGAAAGGCAGGGGTGG - Intergenic
1022323089 7:29305144-29305166 GAGGATACGACAGGCAGGCCAGG + Intronic
1022774263 7:33508694-33508716 AACATTAAGCCAGGCAGGGCTGG + Intronic
1022798806 7:33755410-33755432 GAGATTATCTCAGACTGGGCTGG - Intergenic
1023666735 7:42530439-42530461 GAGCTTGTGAAAGGCAGGGCTGG - Intergenic
1023961189 7:44927726-44927748 GAGATTGAGACAGGCTGGACTGG + Intergenic
1025114595 7:56246697-56246719 AAGAATTTGACAGGCAGGCCGGG - Intergenic
1027191699 7:76000407-76000429 CAGGCTGTGACAGGCAGGGCAGG + Intronic
1028356309 7:89914404-89914426 GGAATTATGACAGGCAGTGCTGG + Intergenic
1031653555 7:124322750-124322772 GAAAATAAAACAGGCAGGGCAGG - Intergenic
1034533194 7:151710270-151710292 GAGATAGAGACAGGCTGGGCGGG - Intronic
1034829131 7:154294158-154294180 GAGAAACTCACAGGCAGGGCCGG + Intronic
1035225970 7:157432389-157432411 GAGAATGAGACAGGCAGGCCGGG - Intergenic
1036114225 8:5940956-5940978 GAGGCTATGACAGGCAGGTGGGG - Intergenic
1036243321 8:7096690-7096712 GGGATGTGGACAGGCAGGGCAGG + Intergenic
1039984486 8:42436266-42436288 GAGTTCAGGACAGGCCGGGCTGG - Intronic
1044576772 8:93778528-93778550 GAGCTTATGTAAGGCAGGCCTGG + Intronic
1045641824 8:104259874-104259896 GAAAGCATGTCAGGCAGGGCAGG + Intergenic
1046117640 8:109803432-109803454 GAAATTTTCCCAGGCAGGGCAGG - Intergenic
1048192347 8:132301362-132301384 GAAGGTATGACAGGCAGGGAGGG - Intronic
1048280177 8:133099905-133099927 TAGATTATAAGAGGCAAGGCAGG - Intronic
1048287171 8:133150967-133150989 GAGAGCATGCCAGGCAGGGCAGG - Intergenic
1049085246 8:140473574-140473596 GAGATCAGCACAGCCAGGGCAGG + Intergenic
1049916964 9:327204-327226 AAGATTCTGATAGGCAGGGGTGG - Intronic
1052386544 9:27829911-27829933 GAGATTATTACAGTCAGGAAGGG + Intergenic
1054452462 9:65410431-65410453 GACAGGATGACAGGCAGGACAGG + Intergenic
1055596086 9:77865659-77865681 GAGACTGTGACTGGCAGAGCTGG - Intronic
1056821611 9:89846029-89846051 AAGATTATGGCACGGAGGGCAGG + Intergenic
1058326811 9:103708672-103708694 GAAATTATCACACGCAGGCCTGG - Intergenic
1058577022 9:106414843-106414865 GCTATTATGACAGGAAGGGGAGG - Intergenic
1058991409 9:110257513-110257535 CAGGTTATGTCTGGCAGGGCTGG + Intergenic
1059895333 9:118857559-118857581 GAGCTTTTGCCAGGCAGGCCTGG - Intergenic
1060739321 9:126087904-126087926 GGGAATATGACAAGCTGGGCAGG + Intergenic
1061359367 9:130131455-130131477 GAGGTTGTCACAGGCAGGGCGGG - Intronic
1061505460 9:131029369-131029391 CAGATGAAGACAGGCAGGGAGGG + Intronic
1061958913 9:133978128-133978150 GAGGCCAGGACAGGCAGGGCTGG + Intronic
1187480704 X:19652529-19652551 GAGATTGTGTCAGGGAGGGAGGG - Intronic
1188120479 X:26299964-26299986 GTGATTATGATAGGCTGGGTGGG - Intergenic
1192277287 X:69646868-69646890 GAGCTTTTGAAAGGCAGGTCTGG + Intronic
1195466315 X:105183129-105183151 CAGATTGTGATAGGCAGGGCAGG + Intronic
1200921888 Y:8620557-8620579 GAGAATAGTACAGGCAGAGCAGG - Intergenic