ID: 989082286

View in Genome Browser
Species Human (GRCh38)
Location 5:37635814-37635836
Sequence ATGTGTCATGGGAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 500}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989082274_989082286 18 Left 989082274 5:37635773-37635795 CCACCCAAATCTCATCTTGAATT 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
Right 989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 36
4: 500
989082272_989082286 20 Left 989082272 5:37635771-37635793 CCCCACCCAAATCTCATCTTGAA 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
Right 989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 36
4: 500
989082275_989082286 15 Left 989082275 5:37635776-37635798 CCCAAATCTCATCTTGAATTGTA 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
Right 989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 36
4: 500
989082273_989082286 19 Left 989082273 5:37635772-37635794 CCCACCCAAATCTCATCTTGAAT 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
Right 989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 36
4: 500
989082276_989082286 14 Left 989082276 5:37635777-37635799 CCAAATCTCATCTTGAATTGTAG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
Right 989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 36
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989082286 Original CRISPR ATGTGTCATGGGAGGGTGGG AGG Intronic
900710072 1:4108017-4108039 GTGTGTTTTGGGGGGGTGGGTGG - Intergenic
900735299 1:4296011-4296033 ATGACTGATGGGTGGGTGGGTGG - Intergenic
900785098 1:4644396-4644418 ATGTGTCCTGAGAAGGGGGGTGG + Intergenic
900785126 1:4644474-4644496 ACGTGTCCTGGGAAGGGGGGTGG + Intergenic
900861197 1:5233395-5233417 ACATGCCTTGGGAGGGTGGGAGG + Intergenic
902266161 1:15266751-15266773 AGGGGTCAGGGGAAGGTGGGGGG - Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902811395 1:18889993-18890015 AAAGGTAATGGGAGGGTGGGAGG - Exonic
902873306 1:19326847-19326869 GTGTGTCTTGGGGGAGTGGGAGG + Intronic
903539725 1:24090130-24090152 AGGGAGCATGGGAGGGTGGGGGG + Intronic
904380948 1:30110514-30110536 GTGAGTGATGGGAGGATGGGAGG - Intergenic
904876847 1:33661928-33661950 GTGTGTGGTGGGAGGGAGGGGGG - Intronic
905180530 1:36162830-36162852 ATGTCCGATGGGTGGGTGGGTGG - Intronic
905804909 1:40869273-40869295 AGGTCTCATGAGAGGGTGTGGGG + Intergenic
906862460 1:49376285-49376307 TTGTATCCTGGGAGGCTGGGAGG + Intronic
907576949 1:55535079-55535101 ATGCGCCATGGGTGGGTGGTGGG - Intergenic
908122749 1:61001358-61001380 ATGTGTATTGTGAGGGAGGGAGG - Intronic
908474588 1:64474915-64474937 ATGAGGCCTGGGAGGGAGGGAGG + Intronic
910482390 1:87672747-87672769 GGGTGTCTTGGGTGGGTGGGAGG + Intergenic
912490337 1:110059299-110059321 GTGTTTACTGGGAGGGTGGGAGG + Intronic
912666011 1:111580328-111580350 ATGGAGCATGGGAAGGTGGGAGG + Intronic
914351352 1:146842940-146842962 ATGGATGATGGGTGGGTGGGTGG + Intergenic
914469222 1:147959542-147959564 GTGGGTGCTGGGAGGGTGGGTGG - Intronic
915320212 1:155052121-155052143 TTGTGTGTTGGGGGGGTGGGGGG + Intronic
915784787 1:158597713-158597735 ATGTGTCATGGGAGGGACCCAGG - Intergenic
915832671 1:159145773-159145795 ATCTGTCAGAGGTGGGTGGGAGG - Intronic
915931762 1:160065070-160065092 ATTTGTGTTGGGGGGGTGGGTGG + Intronic
916371007 1:164094046-164094068 ATGTGTCAAGGGAGGTCAGGTGG - Intergenic
917638120 1:176956649-176956671 ATGGGTCAGGGGAGGCAGGGAGG - Intronic
920065220 1:203264462-203264484 ATGTGTCAGGGCGGGGTGTGGGG + Intronic
920658093 1:207891300-207891322 ATGTGTCATGTGTAGGGGGGTGG + Intronic
921942400 1:220855631-220855653 AAGGGTAATGGGAGGGTGAGTGG - Intergenic
921950715 1:220927175-220927197 TTTTGTCCTTGGAGGGTGGGTGG + Intergenic
922471770 1:225881614-225881636 AGGTGTCAAGGGAGGGTCAGTGG + Intronic
922593853 1:226798841-226798863 ATGAGTCCTGGGACAGTGGGAGG - Intergenic
923031929 1:230256002-230256024 ATGTGTCATCACATGGTGGGAGG + Intronic
924118868 1:240776379-240776401 ACGTGTCAGTGGAGGGAGGGAGG - Intronic
924172663 1:241357505-241357527 CTGTGCGATGGGTGGGTGGGTGG + Intergenic
1062969754 10:1638013-1638035 ATGGGTCTTGGGTGGCTGGGAGG + Intronic
1062997192 10:1877531-1877553 CTGGGCCATGGGAGGGGGGGTGG + Intergenic
1063475618 10:6326275-6326297 GTCTGTCAGGGGAGTGTGGGTGG + Intergenic
1065628410 10:27653997-27654019 TTATGTCAGGGGAGGCTGGGTGG + Intergenic
1066228738 10:33411288-33411310 ACCTGTCAGGGGAGGGTGGGGGG - Intergenic
1067250885 10:44586460-44586482 GTGTGGCAAGGGAGGGAGGGTGG + Intergenic
1067815878 10:49476623-49476645 ATGGGTCATGGGAGGTGGGATGG - Intronic
1068720832 10:60244273-60244295 ATGAGACATGGGAGGGTTGGGGG - Intronic
1068776370 10:60872555-60872577 AGGTGGCAGGGGAGGGCGGGAGG - Intronic
1069214774 10:65805343-65805365 ATGGGGCATTGGAGGGTGGTAGG + Intergenic
1069340003 10:67398701-67398723 ACGTGTCATGGGAGGGTACCTGG + Intronic
1069553200 10:69378979-69379001 AAGTGTTCTGGGAGGGTCGGGGG - Intronic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1070520935 10:77252974-77252996 ATGTGTGATGGGAGGGGTTGAGG - Intronic
1070560585 10:77563727-77563749 ATGTGTTAGGGGAGGATGAGAGG - Intronic
1070647236 10:78210505-78210527 AGCTGGCTTGGGAGGGTGGGGGG + Intergenic
1070713443 10:78700288-78700310 TTGTGTACTGGGGGGGTGGGAGG - Intergenic
1072785882 10:98282052-98282074 ATGGGTCAAGGGAGGCTGGATGG - Intergenic
1072803264 10:98407871-98407893 ATGTGGCATGGGGGAGTGGAGGG - Intronic
1073012773 10:100374084-100374106 GTGTGTGGTGGGAGAGTGGGAGG + Intergenic
1073077324 10:100832317-100832339 AGGTGCCAGGGGAGGGGGGGGGG + Intergenic
1073463931 10:103682842-103682864 ATGGGCCATTGGAGGGTGGCAGG + Intronic
1073959852 10:108912850-108912872 ATGTGTCGGGGGCGGGTTGGGGG + Intergenic
1073996157 10:109317589-109317611 ATGTGAGTTGGGAGTGTGGGTGG - Intergenic
1074328629 10:112479652-112479674 ATGAGTTACGGGAAGGTGGGGGG - Intronic
1075170962 10:120113988-120114010 AAGTGTAATGTGAGGCTGGGAGG - Intergenic
1075454945 10:122579070-122579092 ATGTGATATTGGAGGGTGGAGGG + Intronic
1076450024 10:130551023-130551045 ATGTGTCAGGGGAGGGGCTGAGG - Intergenic
1077118849 11:897667-897689 CTGTGTGAAGGGAGGCTGGGAGG - Intronic
1077801782 11:5546482-5546504 ATGTGTCGGGGGAAGATGGGAGG - Intronic
1078062460 11:8056784-8056806 ATGTGGTTTGGGAGGGTGAGGGG + Intronic
1078395062 11:10973818-10973840 ACATGTCATGGTAGGGTGGTGGG + Intergenic
1078467621 11:11561865-11561887 AGGTGAAATGGGAGGGTGTGTGG - Intronic
1078484231 11:11706850-11706872 AGGTGTCGTGGGAGGCTGGAAGG + Intergenic
1079242854 11:18732970-18732992 ATCTGTCCTGGCAGGCTGGGAGG + Intronic
1079552975 11:21723874-21723896 ATGTATCACAGGAGGGTGGCAGG - Intergenic
1079951385 11:26809419-26809441 GCCTGTCATGGGAGTGTGGGGGG - Intergenic
1080419776 11:32099497-32099519 GTGGGTCTTTGGAGGGTGGGTGG + Intronic
1081571579 11:44294589-44294611 ATGAGTGATGGGAGGGGCGGGGG - Intronic
1081655645 11:44855751-44855773 AGATGTCAGGGGAAGGTGGGTGG - Intronic
1083273373 11:61583251-61583273 ATCTGTTGTGGGAGGGTGAGGGG - Intergenic
1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG + Intronic
1084302845 11:68262503-68262525 AAGTGTCATGGGAGTGCTGGAGG + Exonic
1084596245 11:70118653-70118675 ATGATTGATGGGTGGGTGGGTGG + Intronic
1084596307 11:70118939-70118961 ATGGGTGATGGGTGGGTAGGTGG + Intronic
1084596379 11:70119249-70119271 ATGGATGATGGGGGGGTGGGTGG + Intronic
1084596392 11:70119302-70119324 ATGGGTGATGGGTGGGTGGATGG + Intronic
1084785708 11:71440573-71440595 ATGGGTGATGGGAGGGTAGATGG + Intronic
1084906776 11:72354601-72354623 AGGTGTGGTGGGAGGGAGGGAGG - Intronic
1084923052 11:72487401-72487423 ATGTGTCAATGGAGGCTGGGTGG + Intergenic
1085142781 11:74163464-74163486 ATGTGTCATGGGAAGGACCGGGG + Intronic
1085737589 11:79052629-79052651 ATGTGGCGAGGGAGGGAGGGAGG + Intronic
1086090106 11:82996990-82997012 AAGAGGCATGGGAGGGTTGGTGG + Intronic
1087280032 11:96199586-96199608 ATGTGTCCTGGGAATGTGTGCGG + Intronic
1089458334 11:118638689-118638711 ATTGGTCAAGGGAGGGAGGGAGG + Intronic
1090894969 11:130964091-130964113 AGGTGGCCAGGGAGGGTGGGGGG + Intergenic
1091384058 12:80994-81016 TTGGGGCATGGGAGGGTAGGAGG + Intronic
1091676594 12:2495425-2495447 AGGTGGCAGTGGAGGGTGGGTGG + Intronic
1091678652 12:2510414-2510436 ATGTGTTTTGGGAGTGTGAGAGG - Intronic
1092459335 12:8672631-8672653 ATGTGTCATGGGAGGGACTCAGG - Intergenic
1093625949 12:21348382-21348404 AAGTGTCATGGGGGGCTGTGAGG - Intronic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1095804781 12:46307185-46307207 TTGTGGGATGGGGGGGTGGGGGG - Intergenic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096890273 12:54763098-54763120 AAATGTCTTGGGAGGGGGGGAGG - Intergenic
1097797539 12:63880002-63880024 ATGTGTCATGGGAGGGACCTGGG + Intronic
1098014624 12:66091455-66091477 AGGTGAGGTGGGAGGGTGGGAGG - Intergenic
1099629228 12:85119173-85119195 AGTTGTCATGGGTTGGTGGGAGG - Intronic
1099700199 12:86074007-86074029 ATGTGTCATGGGAGGGATCGGGG + Intronic
1100186631 12:92146091-92146113 TTGTGTCGAGGGAGGGAGGGAGG + Intergenic
1100189828 12:92178525-92178547 AGGTGTGATGGGAGGGGAGGTGG + Intergenic
1101496935 12:105263618-105263640 ATGTGTAATGGGAACATGGGAGG - Intronic
1102219057 12:111182093-111182115 ATGTTTCAGGGCAGGGTCGGGGG + Intronic
1102460433 12:113096625-113096647 ATGTGGCAGGGGAGGGAGGGAGG + Intronic
1102729338 12:115094319-115094341 GTGTGTCATGGCAGTGTGGGAGG + Intergenic
1102950456 12:117027563-117027585 ATGTGTCACGGCGGGGGGGGTGG - Intronic
1103028926 12:117596340-117596362 ATGTGTCATGGGAGGGACCCGGG - Intronic
1103842865 12:123879471-123879493 ATGGGGCAAAGGAGGGTGGGTGG + Intronic
1104090794 12:125515689-125515711 ATGTGTTGTGTGAGTGTGGGAGG - Intronic
1104896262 12:132166496-132166518 ATGGATGATGGGTGGGTGGGTGG - Intergenic
1104896298 12:132166632-132166654 ATGGATGATGGGTGGGTGGGTGG - Intergenic
1104896307 12:132166659-132166681 ATGGATGATGGGTGGGTGGGTGG - Intergenic
1104896320 12:132166702-132166724 ATGTATGATGGATGGGTGGGTGG - Intergenic
1104925951 12:132313970-132313992 GTGGGTGATGGGTGGGTGGGTGG - Intronic
1105650285 13:22370080-22370102 ATGGGTTGTGGGAGGGTGGGGGG - Intergenic
1105986912 13:25576410-25576432 GTGGTTCATGGGAGGGTTGGTGG + Intronic
1106133533 13:26958337-26958359 TTGCTCCATGGGAGGGTGGGGGG + Intergenic
1107707541 13:43122564-43122586 ATCTCTCATGGGAGGGGGTGGGG - Intergenic
1107806128 13:44155623-44155645 ATGTGGTATGGGAGGCAGGGAGG + Intronic
1107832909 13:44390299-44390321 AAGTGTCCAGGGCGGGTGGGTGG - Intronic
1107988431 13:45796325-45796347 ATATTTCATGGGCGGGGGGGAGG + Intronic
1108589586 13:51901429-51901451 GTGAGGCATGGGAGGGCGGGTGG - Intergenic
1109206597 13:59489591-59489613 ATCTGTTATGAGAGGCTGGGAGG - Intergenic
1110997103 13:82124174-82124196 AAGAATAATGGGAGGGTGGGGGG - Intergenic
1112144315 13:96680432-96680454 AAGTGTCATTTGAGGCTGGGTGG + Intronic
1112675211 13:101693501-101693523 ATGTCTTATTGGAGGGTGGAGGG + Intronic
1113399291 13:109976402-109976424 ACGGGTCCTGGGAGGTTGGGAGG - Intergenic
1113414102 13:110114411-110114433 ATCTGTCACTGGAGGGTGGCTGG + Intergenic
1113632965 13:111900369-111900391 ATGGGTCTTGTGAGGGTGGAGGG + Intergenic
1116415402 14:44671999-44672021 ATGTGTCATGGGAGGGACCTGGG - Intergenic
1117016617 14:51525003-51525025 TTGTGTGTTGGGTGGGTGGGTGG + Intronic
1118441744 14:65818516-65818538 TTGTGTGTGGGGAGGGTGGGGGG - Intergenic
1121209066 14:92193003-92193025 ATGTGGGATGGGAGGGGAGGCGG + Intergenic
1121816226 14:96931150-96931172 ATTTGTCCTGGGAGAGAGGGTGG + Intronic
1122124240 14:99570570-99570592 GAGGGTCATGGGAGGGTGTGGGG + Intronic
1122129610 14:99597504-99597526 CTGTGTCAGGGGAGGTTGCGTGG - Intronic
1122585464 14:102803094-102803116 ATGTGTCATGGGAGGGACCTGGG - Intronic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123956110 15:25336224-25336246 GTGGCTCATGGAAGGGTGGGAGG + Intronic
1124402347 15:29360608-29360630 ATGTGTCAACTGAGAGTGGGAGG - Intronic
1125033252 15:35093763-35093785 CTGAGTGGTGGGAGGGTGGGAGG + Intergenic
1126411952 15:48381168-48381190 ATGTGGCCTGGGAGGGTTGTAGG - Intergenic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1128471772 15:67959930-67959952 AGCTGTCATGGGAGAGTGGATGG + Intergenic
1129689456 15:77705158-77705180 GTGTGTCATGGCAGGGGGAGGGG - Intronic
1129937931 15:79466163-79466185 AAGTTACATGGAAGGGTGGGAGG - Intronic
1130325680 15:82877901-82877923 ATGGGACCTTGGAGGGTGGGGGG + Intronic
1131086745 15:89581971-89581993 AGGTGTCATGGGAGTGAGGCAGG - Intronic
1131678877 15:94700961-94700983 CTGTGTCAATAGAGGGTGGGTGG + Intergenic
1131957743 15:97755608-97755630 GTGTGTGTTGGGTGGGTGGGTGG - Intergenic
1132045178 15:98557625-98557647 GTGTGTAATGGCGGGGTGGGGGG + Intergenic
1132177603 15:99727889-99727911 CTGTGGCATGGAGGGGTGGGAGG - Exonic
1132477196 16:146136-146158 AGTTGTCATGGGAGTGTGGCTGG + Intergenic
1132583822 16:697230-697252 CTGGGTGGTGGGAGGGTGGGTGG + Exonic
1132590052 16:722600-722622 ATGTTTTATGGGGGGCTGGGTGG + Exonic
1132803476 16:1765293-1765315 ATGTGGCAGTGGACGGTGGGAGG + Intronic
1133216723 16:4297111-4297133 ATGTGTCATGGGAGGGGGACAGG + Intergenic
1134105952 16:11486161-11486183 ATAGATGATGGGAGGGTGGGCGG + Intronic
1134106020 16:11486524-11486546 ATAGATGATGGGAGGGTGGGTGG + Intronic
1134106045 16:11486613-11486635 ATGGATGATGGGTGGGTGGGTGG + Intronic
1134106080 16:11486737-11486759 ATGGATAATGGGTGGGTGGGTGG + Intronic
1134106089 16:11486768-11486790 ATGGATAATGGGTGGGTGGGTGG + Intronic
1134106132 16:11486900-11486922 ATGAATCATGGGTGGGTGGTAGG + Intronic
1134106146 16:11486950-11486972 ATGGATAATGGGTGGGTGGGTGG + Intronic
1134224756 16:12381499-12381521 ATGAATGATGGGTGGGTGGGTGG - Intronic
1134224792 16:12381618-12381640 ATGAATGATGGGTGGGTGGGTGG - Intronic
1135648526 16:24185435-24185457 GTATGACAGGGGAGGGTGGGAGG - Intronic
1136269820 16:29141820-29141842 CTGTGGCATGGGGGGGTGGTGGG + Intergenic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1137678645 16:50318766-50318788 TTTTGTCAGGGGTGGGTGGGAGG + Intronic
1137702261 16:50505870-50505892 CAGTGTCCTGGGAGGTTGGGGGG - Intergenic
1137704066 16:50521740-50521762 ATGTGTCAAGTGAAGGAGGGTGG - Intergenic
1137707535 16:50545852-50545874 ATTTGTTCTGGTAGGGTGGGGGG + Intergenic
1137786338 16:51140522-51140544 ATGAGGCTTGGGAGGGTTGGGGG + Exonic
1138350794 16:56345292-56345314 ATGTGCCATGGGAGGGAGGAGGG + Exonic
1139431805 16:66914767-66914789 ATGAGTGATGGGAGGTTGGATGG + Intronic
1139846191 16:69923304-69923326 GTGTGTGTTGGGGGGGTGGGGGG + Intronic
1139982686 16:70872610-70872632 ATGGATGATGGGTGGGTGGGTGG - Intronic
1140517407 16:75553978-75554000 ATGTGATAGGGGATGGTGGGAGG - Intronic
1140864923 16:79051562-79051584 CTGTGTGCTGGGTGGGTGGGAGG + Intronic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141505100 16:84471691-84471713 ACGTGTCATGGGAGGGAGCCGGG + Intergenic
1141516445 16:84548200-84548222 ATGTCACATAGGAGGGGGGGGGG + Intronic
1141589211 16:85056543-85056565 CTGTGTCTTGGAAGGCTGGGTGG - Intronic
1141626468 16:85264142-85264164 ACCTGTTGTGGGAGGGTGGGGGG + Intergenic
1203139622 16_KI270728v1_random:1753044-1753066 GGGAGTCATGGGGGGGTGGGGGG - Intergenic
1143013501 17:3879330-3879352 GTGTGTCATCGGAGGGTGAGAGG - Intronic
1143617861 17:8064275-8064297 ATGGGTCAGGGGAGGGGGGCTGG + Intergenic
1143703508 17:8680095-8680117 ATGAGTCATTGGATGGTTGGTGG - Intergenic
1144121394 17:12157328-12157350 ATCTATCAGGGGAGGGAGGGGGG - Intergenic
1145056143 17:19705363-19705385 AGGTGTCATAGGAGGGGGGCAGG - Intronic
1145271564 17:21407556-21407578 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145309778 17:21695004-21695026 ATGGGTAATGGGTGGGTGGATGG - Intronic
1146550634 17:33777512-33777534 ATGTGTCATGGTGGGTTGGTGGG - Intronic
1147374255 17:40014761-40014783 ATGAGTCATGGGGGGCGGGGGGG + Intergenic
1147459808 17:40560985-40561007 ATGAGTCAGTGGAGGGCGGGTGG - Intronic
1147882884 17:43665339-43665361 CTGGGTCATGGTGGGGTGGGTGG + Intergenic
1148652730 17:49261193-49261215 ATGTGTGTGGGGAGTGTGGGTGG - Intergenic
1150626854 17:66847570-66847592 ATGTGTCATGGGAGGGACCAGGG - Intronic
1150649563 17:67001016-67001038 ATGTGTCATGGGAGGGACCTGGG + Intronic
1150883571 17:69059099-69059121 ATCTGTCATGGGAGGGACGCAGG - Intronic
1151121404 17:71796989-71797011 ATGTGTCATGGGAGGGACCTGGG + Intergenic
1151229570 17:72674147-72674169 ATGTGGCAAGGGAGGGAAGGAGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151833562 17:76569487-76569509 ATTTGGGGTGGGAGGGTGGGAGG + Intronic
1151885076 17:76918659-76918681 ATGGGCCATGGCAGGGTTGGGGG + Intronic
1152226045 17:79093269-79093291 CTGGGTGGTGGGAGGGTGGGAGG - Intronic
1152239022 17:79152037-79152059 AGGGGTGATGGGAGGCTGGGAGG + Intronic
1152972872 18:181892-181914 ATGTATGGTGGGAGGGAGGGAGG + Intronic
1153275729 18:3365810-3365832 ATATGTAATGGGAGTATGGGAGG + Intergenic
1155554358 18:27001689-27001711 ATGCATGGTGGGAGGGTGGGAGG + Intronic
1156352211 18:36311200-36311222 ATGTGTCTGGGCAGGGAGGGCGG + Intronic
1156505038 18:37585108-37585130 GTGTGTGAGGGCAGGGTGGGAGG + Intergenic
1156916149 18:42466072-42466094 AAGTTTCATGGGAGAGTAGGTGG - Intergenic
1157204116 18:45684115-45684137 ATGTGTGCTTGGAGGGTGGTGGG - Intergenic
1157689407 18:49668824-49668846 AAGTGGCAGGGGTGGGTGGGTGG + Intergenic
1160526663 18:79542592-79542614 ATGGATAATGGGTGGGTGGGTGG - Intergenic
1160717420 19:582612-582634 AGGTGTGGTGGGTGGGTGGGCGG + Intronic
1160717505 19:583007-583029 CTGAGTCATGGCCGGGTGGGCGG + Exonic
1160926818 19:1550416-1550438 ATGTTGAATGGGTGGGTGGGTGG - Intergenic
1161329806 19:3681129-3681151 ATGTGGGATGGGAGTGGGGGCGG + Intronic
1161347644 19:3776215-3776237 ATGTGTGAATGGATGGTGGGTGG + Intergenic
1162859573 19:13495961-13495983 ATGGGTGATTGGAGGGTAGGTGG - Intronic
1163455591 19:17404183-17404205 ATCTCTCCTGGTAGGGTGGGAGG + Exonic
1164209864 19:23089458-23089480 ATGTGTTATGGGAGGGACCGGGG + Intronic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164857616 19:31537274-31537296 CTGGGTTATGGGAGGGTGAGAGG - Intergenic
1164901536 19:31930245-31930267 GTAAGTCAGGGGAGGGTGGGGGG + Intergenic
1165161162 19:33817297-33817319 ATGTGTGATGAGAATGTGGGTGG + Intergenic
1166546415 19:43636772-43636794 CTGGCTCATGGGTGGGTGGGTGG + Intronic
1167194219 19:48016064-48016086 ATGTGTGGTGGGAGGGAGAGTGG + Intronic
1167215499 19:48161700-48161722 ATGTGTGATGGGTGGGTGAGTGG - Intronic
1167535135 19:50045337-50045359 GTGTGTCATGACTGGGTGGGTGG - Exonic
1168498911 19:56876987-56877009 CTGTGTCATGGGTGGGAGGGAGG - Intergenic
1168591001 19:57634102-57634124 ATCTGTCTGGGGAGGGTGGAGGG - Intronic
925861012 2:8174885-8174907 ATGTGTCACTGGAGGCTGAGTGG + Intergenic
926525826 2:13979306-13979328 TTGTCTCATGGGTGGGAGGGTGG - Intergenic
926685115 2:15692099-15692121 TTGGGTAATGCGAGGGTGGGTGG + Intronic
927681976 2:25145802-25145824 ATGTGTCAGGGGAGGGGAGGGGG - Intronic
927871155 2:26624724-26624746 AAGTTTAGTGGGAGGGTGGGGGG + Intronic
928356244 2:30618560-30618582 ACTTGACAAGGGAGGGTGGGAGG + Intronic
928491523 2:31788746-31788768 ATGTGGCATGAGAGGGCGAGAGG + Intergenic
929562831 2:42966422-42966444 ATGTGGCGGGGGGGGGTGGGGGG + Intergenic
929864216 2:45704490-45704512 ATGTGACTTGGGAGTGTTGGGGG + Intronic
930694201 2:54394696-54394718 ATGTGTGGAGGGAGGGAGGGAGG - Intergenic
932451305 2:71812370-71812392 ATGGGTCCTGGGCAGGTGGGAGG + Intergenic
932714288 2:74090370-74090392 AGGTGTCCTGGGAAGATGGGGGG - Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
934818438 2:97350842-97350864 ATGTTTCATGGTATGGTTGGTGG + Intergenic
935160365 2:100524472-100524494 ATGAGTCATGGTAGGGTGGAGGG - Intergenic
935452183 2:103222635-103222657 ATGTGTCCTGGAAGGGGGAGCGG + Intergenic
936152722 2:110030524-110030546 ATGGCTCAGGGGAGGGCGGGGGG - Intergenic
936191958 2:110340888-110340910 ATGGCTCAGGGGAGGGCGGGGGG + Intergenic
937248947 2:120511381-120511403 GTGTGTGTTGGGGGGGTGGGGGG - Intergenic
937318364 2:120946399-120946421 TTGTGCCATGGGAGTGTGTGAGG + Intronic
938079645 2:128362897-128362919 CCCTGTCTTGGGAGGGTGGGGGG + Intergenic
940400809 2:153245605-153245627 GTGTGTGTTGGGAGGGGGGGAGG - Intergenic
940433694 2:153625221-153625243 ATGGCTCAGGGGAGAGTGGGGGG + Intergenic
942799496 2:179860486-179860508 AGGTGTCAGGGAAGGGTGGGAGG - Intronic
943668435 2:190634942-190634964 ATGTGTCACAGGAGGCAGGGTGG - Intergenic
944064584 2:195605333-195605355 AAGTGGGATGAGAGGGTGGGTGG - Intronic
944103517 2:196054698-196054720 ATGTGTCATGGGAGGGACCTGGG + Intronic
945500791 2:210571911-210571933 ATGTGTAATGGGAGTGGAGGTGG + Intronic
946438877 2:219678492-219678514 GTGTGTCATGGTATGGGGGGTGG + Intergenic
947020280 2:225666850-225666872 GTGTGTGTTGGGGGGGTGGGGGG - Intergenic
947195655 2:227564237-227564259 ATCTGTATTGGGTGGGTGGGTGG + Intergenic
948322083 2:237078542-237078564 ATGTGTCATGGGAGGGACCTGGG + Intergenic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1169109514 20:3022836-3022858 GTGGGTCAGGTGAGGGTGGGGGG + Intronic
1169742654 20:8912167-8912189 ATGTGTCATGGGAGGGACCCAGG + Intronic
1170627392 20:18040243-18040265 AAGTCTGTTGGGAGGGTGGGTGG + Intronic
1173493302 20:43500838-43500860 ATGTGTCAAGGGAGAGGGGGAGG + Intergenic
1174651580 20:52130149-52130171 AAGTGCCATGGCAGGGTGGAGGG - Intronic
1174671480 20:52311884-52311906 AAATAACATGGGAGGGTGGGAGG - Intergenic
1175401351 20:58701418-58701440 AGGTGTCATGGGGTGGGGGGCGG + Intronic
1176410206 21:6445691-6445713 AGGTGCCGTGGGAGGCTGGGTGG + Intergenic
1177950208 21:27526557-27526579 ATGTGTCATGGGAGGGACCCTGG + Intergenic
1177952076 21:27551490-27551512 ATGTGTCATGGGAGGTTTCTAGG - Intergenic
1178454904 21:32739985-32740007 ATGTGTCATGGAAGGGTTTAAGG - Intronic
1179130852 21:38636005-38636027 ATGTGTCATGGGAGGGACCAGGG + Intronic
1179140808 21:38723268-38723290 ATCCTTCATGGGAGGATGGGAGG - Intergenic
1179530305 21:42013935-42013957 AAGCCACATGGGAGGGTGGGTGG - Intergenic
1179643026 21:42759601-42759623 ATGTGTGGTGGGAGTGTGTGGGG + Intronic
1179685699 21:43054013-43054035 AGGTGCCGTGGGAGGCTGGGTGG + Intronic
1180015509 21:45080209-45080231 AAGAGTCATGGGATGGTGGCTGG + Intronic
1180024961 21:45155838-45155860 ATGGATGATGGGTGGGTGGGTGG - Intronic
1180025159 21:45156611-45156633 ATGGGTGATGGGTGAGTGGGTGG - Intronic
1180045620 21:45303804-45303826 AGGGGCCCTGGGAGGGTGGGAGG + Intergenic
1181053163 22:20247121-20247143 CTGTGTCATGGGTGGCCGGGAGG + Intronic
1181813810 22:25421498-25421520 ATGGGGCATCGGAGGGCGGGTGG + Intergenic
1181966725 22:26661420-26661442 ATGAGTCATGGAAGGGAGGCGGG + Intergenic
1182326913 22:29520172-29520194 GTGGGGCATGGGAGGGTGGGAGG - Intronic
1182409158 22:30167958-30167980 GTGTGTGATGGGAGGGGGAGTGG - Intronic
1183082147 22:35463419-35463441 ATGAATCATGGGTGGATGGGTGG - Intergenic
1183330255 22:37216190-37216212 CTGTGGGATGGGGGGGTGGGAGG - Intergenic
1183520334 22:38293159-38293181 ATGTGTTGTGGAGGGGTGGGTGG - Intronic
1184268893 22:43366283-43366305 GTGTGTCTGGGGTGGGTGGGCGG - Intergenic
1184744631 22:46449174-46449196 ATGTGTGATGGGTGGTTGGATGG - Intronic
1184744666 22:46449346-46449368 ATGTGTGATGGGTGGTTGGATGG - Intronic
1184744673 22:46449377-46449399 ATGTGTGATGGGTGGTTGGATGG - Intronic
1184900627 22:47444415-47444437 ATGTCTGATGGGCAGGTGGGTGG + Intergenic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
1185276044 22:49950548-49950570 CTGTGTTATAGGGGGGTGGGGGG + Intergenic
949531387 3:4959252-4959274 GTGTGTCAGGGGAGAGTTGGGGG + Intergenic
949894340 3:8758151-8758173 ATGATTCATGGAGGGGTGGGAGG + Intronic
949895183 3:8763165-8763187 ATGTGTCCGGGGAGGCTGGGAGG - Intronic
951155577 3:19349355-19349377 GTGCATCATGGGTGGGTGGGAGG - Intronic
951463642 3:22978003-22978025 ATGTGAGATGGGAGCATGGGAGG - Intergenic
951581236 3:24166047-24166069 ATGTGTCATGGGAAGATGGTTGG - Intronic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952125115 3:30290953-30290975 GGGGGTCATGGGAGGGAGGGAGG - Intergenic
952307709 3:32160439-32160461 ATGGATGATGGGTGGGTGGGTGG + Intronic
952307739 3:32160545-32160567 ATGGATGATGGGTGGGTGGGTGG + Intronic
953201208 3:40780136-40780158 TTGTTTCATGGGAAGATGGGAGG + Intergenic
953585827 3:44200194-44200216 GTGTGGGATGGGGGGGTGGGGGG - Intergenic
954542083 3:51400262-51400284 AAGTGTCACAGGAGGGTGTGGGG + Intronic
955051048 3:55411368-55411390 ATGTATCATAGGTGAGTGGGAGG + Intergenic
955126014 3:56113732-56113754 ATCTGAAGTGGGAGGGTGGGGGG - Intronic
955197483 3:56818614-56818636 ATGGCTTATGGCAGGGTGGGTGG - Intronic
955842100 3:63123613-63123635 ATGTATGATGGGAGGTAGGGAGG + Intergenic
956022412 3:64946710-64946732 ATGTATCCTGGGAGGGTGGGTGG - Intergenic
958019100 3:87977081-87977103 ATATGTAAGGGGATGGTGGGAGG - Intergenic
958193266 3:90210412-90210434 ATGAAAGATGGGAGGGTGGGAGG + Intergenic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
958786581 3:98603247-98603269 AAGTGAAATGGGGGGGTGGGAGG + Intergenic
958886407 3:99732587-99732609 ATGTGTCATGGGAGGGACCCAGG - Intronic
959394090 3:105814910-105814932 GTGTGGCATTAGAGGGTGGGGGG - Intronic
959459247 3:106604413-106604435 ATGGGTCAGGTGAGGCTGGGTGG + Intergenic
960246237 3:115403433-115403455 ATTTGTCCTGGGTGGGTGGAAGG + Intergenic
961403182 3:126661595-126661617 GTGGGTCAGGGGAGGGTGGCTGG - Intergenic
961524440 3:127487647-127487669 AGGTGTGAGGGGAGGGTGGGGGG - Intergenic
961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG + Intronic
962763765 3:138542592-138542614 AGGTGCCAGTGGAGGGTGGGAGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963734213 3:149001762-149001784 ATGTGTTGTGGTGGGGTGGGTGG + Intronic
963826900 3:149965697-149965719 ATGTGCGAAGGGAGGGGGGGCGG + Exonic
964177652 3:153844257-153844279 ATGTGTTCTGGGAGTGGGGGTGG + Intergenic
964946353 3:162230741-162230763 AACTGTCATGGGCTGGTGGGAGG - Intergenic
965204549 3:165704781-165704803 ATTTGTGATGGGAGGATAGGGGG + Intergenic
965225930 3:165990291-165990313 ATGCGTCATGGGGTGGGGGGAGG - Intergenic
968170553 3:196506215-196506237 ATGCATGCTGGGAGGGTGGGGGG + Intergenic
969111069 4:4844605-4844627 TTGTGGCAGGGGAGGGTTGGGGG - Intergenic
969256781 4:6007810-6007832 AGGTTAGATGGGAGGGTGGGTGG + Intergenic
969443478 4:7231476-7231498 ATGAGTGATGGGTGGATGGGTGG - Intronic
970260697 4:14221340-14221362 ATGAGTCATGGGAGGGACTGTGG - Intergenic
971124627 4:23739861-23739883 ATGTGACAAGGTGGGGTGGGAGG - Intergenic
972291632 4:37695227-37695249 ATGTGTCATGGGAGGGATCCAGG - Intergenic
974860483 4:67514933-67514955 ATATATAATGGGTGGGTGGGTGG - Intronic
976082223 4:81368366-81368388 ATGTGTCAAGGCGGGGAGGGGGG - Intergenic
976242941 4:82977383-82977405 AGATGTCATGGGAGGCAGGGGGG - Intronic
977911693 4:102544920-102544942 ATGTGTCAAGGAAGAGTGGAGGG - Intronic
978581393 4:110235311-110235333 AGATGTCATGGGAGGGAGAGAGG - Intergenic
979724198 4:123941420-123941442 ATGTGACATGAGGGAGTGGGTGG + Intergenic
981027140 4:140088201-140088223 AAGTGTGATGGGAGGGAGGAAGG + Intronic
982807465 4:159784185-159784207 ATGTGTCAAGGCAGGGGGTGGGG - Intergenic
983286653 4:165748543-165748565 ATGCTCCCTGGGAGGGTGGGAGG - Intergenic
984519604 4:180786123-180786145 ATGTGTTACGGGAGGCAGGGAGG + Intergenic
984893553 4:184515200-184515222 CTGTCTGATGGGAGGATGGGAGG - Intergenic
985159631 4:187031132-187031154 TTGTGGGATGGGAGGGAGGGGGG - Intergenic
985218758 4:187680636-187680658 ATTTGTCATGAGGGGGTCGGGGG + Intergenic
985652377 5:1112872-1112894 ATTTGTCATGGGTGGGGGGGGGG - Intergenic
985808871 5:2068672-2068694 GTGAGTCAGTGGAGGGTGGGAGG + Intergenic
986098267 5:4581602-4581624 ATTTGTCATGGGAGGCTGAGTGG + Intergenic
986806399 5:11312267-11312289 ATGTGTGTTGGGGGGGTAGGGGG - Intronic
987971072 5:24945305-24945327 ATTTGGCAGGGGAGGGTGGCGGG - Intergenic
988234500 5:28523964-28523986 ATGCTTCCTGGGAGGGTAGGAGG - Intergenic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
989251297 5:39319047-39319069 CTGTGCTATGGGAGGGTTGGGGG - Intronic
990558781 5:56963248-56963270 ATGTGTCGAGAGAGGGAGGGAGG + Intronic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
993526670 5:88973694-88973716 AGGTGGGATGGGAGGGAGGGAGG + Intergenic
993957004 5:94246460-94246482 GTGTGCCTTGGGAGAGTGGGTGG + Intronic
995274159 5:110259066-110259088 ATTTGTCCTGGGAGGCTGAGGGG - Intergenic
996581241 5:125034637-125034659 CTGGGTCATGGGAGGGGTGGGGG - Intergenic
997713417 5:136024891-136024913 GTGGGTCTTGGGAGGTTGGGAGG + Intergenic
998535058 5:142922533-142922555 ATTTGTGATGAAAGGGTGGGAGG - Intronic
1000370308 5:160528737-160528759 GGGTGTCATGGGAGGCTTGGAGG + Intergenic
1000845405 5:166273875-166273897 ATGTGTGGTTAGAGGGTGGGGGG + Intergenic
1001538261 5:172515241-172515263 GTGTGTTCTGGGTGGGTGGGGGG - Intergenic
1001562574 5:172678959-172678981 AAGTGGCTTGGGAGAGTGGGAGG + Intronic
1001672036 5:173481722-173481744 GTGGGCCATGGAAGGGTGGGAGG - Intergenic
1001773620 5:174312881-174312903 ATGTCTCATGGAAGCGTGTGGGG + Intergenic
1003715611 6:8642914-8642936 AAGTGTAATGGGGTGGTGGGGGG + Intergenic
1004287332 6:14333813-14333835 ATGAGTTTTGGGAGGGAGGGTGG - Intergenic
1006186581 6:32184839-32184861 AAGTGTGATGGGTGGGGGGGTGG - Exonic
1006384195 6:33720122-33720144 ATGGGTGAGGGGAGGGCGGGTGG - Intergenic
1006460383 6:34154524-34154546 ATGTGACATGGGTGGGTGGTCGG + Intronic
1006806446 6:36792538-36792560 ATGTGTCACGGGAGGGAGGAAGG + Intronic
1007394539 6:41570063-41570085 GTGTGTCAGGGGGTGGTGGGGGG - Intronic
1007725142 6:43911525-43911547 ATGTGTCTGGGGAGTGTTGGGGG - Intergenic
1007816069 6:44526331-44526353 AGGTTTCAGGGGAGGCTGGGTGG + Intergenic
1007966787 6:46010691-46010713 AAGTGCCATGGCAGGGTGGTGGG - Intronic
1008117193 6:47565684-47565706 ATGAATCATGGTAGGGTGCGAGG - Intronic
1008192138 6:48473145-48473167 GATTGACATGGGAGGGTGGGAGG - Intergenic
1008401445 6:51068273-51068295 AAGTGGCATGGGTGGGTGGTAGG + Intergenic
1008445614 6:51586662-51586684 ATGTGTCAGAGGAGGGCTGGTGG - Intergenic
1011241806 6:85279681-85279703 ATGTGTGGGGGGTGGGTGGGTGG - Intergenic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1011522441 6:88223482-88223504 ATGTGACATGTGAGAATGGGGGG + Intergenic
1012804426 6:103876828-103876850 ACTTGACATGGGAGGGTGGGAGG - Intergenic
1014863397 6:126497751-126497773 ATGTGTCATGGGAGGGACCCAGG - Intergenic
1016633081 6:146254842-146254864 TTATTTCATGGGAGAGTGGGAGG - Intronic
1017386904 6:153896049-153896071 ATGTGTCGGGGGGGGGGGGGTGG + Intergenic
1017408989 6:154149379-154149401 ACGTGTCATGGGAGGGATGGAGG - Intronic
1018086444 6:160305047-160305069 ATGTGTCATGGGAGGGACCTGGG - Intergenic
1018315564 6:162553364-162553386 AAGAGGCAGGGGAGGGTGGGAGG + Intronic
1018326707 6:162677980-162678002 ATGGGTGAGTGGAGGGTGGGAGG - Intronic
1018570433 6:165204137-165204159 ATGTGTTGAGGGAGGGAGGGAGG - Intergenic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1018932155 6:168248032-168248054 ACGTGACATGGTGGGGTGGGGGG - Intergenic
1019076612 6:169393365-169393387 ATGTGTCTTGGGAGGGCTCGTGG + Intergenic
1019107604 6:169681795-169681817 ATCTGTCATGGGAGGAAGTGTGG - Intronic
1019914730 7:4125373-4125395 ATGGGTGATGGGTGGGTGGATGG + Intronic
1020175611 7:5879728-5879750 ATGTCTCAAGGGAATGTGGGTGG - Intergenic
1021366509 7:19786037-19786059 ATGTGTCATGTGAAGTTGAGAGG - Intergenic
1022475738 7:30708356-30708378 GTGTATCTTGGGAAGGTGGGAGG - Intronic
1023223447 7:37944712-37944734 ATGTGTCATGGGAGGGACCTGGG - Intronic
1023987116 7:45103197-45103219 GTGTGGCATGGGAGGGCAGGGGG - Intronic
1025106474 7:56175206-56175228 ATGTGTCAGCCGGGGGTGGGGGG + Intergenic
1026481615 7:70784600-70784622 CTGGGTCATGGGAGGAGGGGAGG - Intronic
1026698119 7:72613994-72614016 ATGTATGCTGGGGGGGTGGGGGG + Intronic
1028350213 7:89837684-89837706 ATGAGTCATTGGAGGGAGGAAGG - Intergenic
1029083218 7:97991241-97991263 ATGTCTCAAGGGAATGTGGGTGG + Intergenic
1030056219 7:105586030-105586052 ACTTGACAGGGGAGGGTGGGAGG + Intronic
1030234847 7:107247214-107247236 ACTTGACAGGGGAGGGTGGGAGG + Intronic
1030599646 7:111579174-111579196 AAGTGTAGTGGGAGGGTTGGGGG + Intergenic
1031359736 7:120834903-120834925 ATGGCTCATGGAGGGGTGGGCGG - Intronic
1031701496 7:124931630-124931652 AAGTGTAATGGGGTGGTGGGGGG - Intergenic
1032198645 7:129804297-129804319 ATGTGTCTTGGGAGGATCTGGGG + Intergenic
1033440448 7:141373643-141373665 ATGTGTGTTGGGGGGGTGGAGGG - Intronic
1033597054 7:142865870-142865892 AGGAGCCAGGGGAGGGTGGGTGG - Intronic
1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG + Intronic
1034883612 7:154780852-154780874 ATGGGTGATGGTTGGGTGGGTGG + Intronic
1035108951 7:156464414-156464436 TTGTGTCCTGGGATGGTGGGAGG - Intergenic
1035347796 7:158217141-158217163 AAGTGCCCTGGCAGGGTGGGTGG - Intronic
1036063827 8:5356275-5356297 TTGTGTCATGGGGGAGTGTGGGG - Intergenic
1036155792 8:6340751-6340773 AAGTGGCATGGCTGGGTGGGAGG - Intergenic
1036186458 8:6626650-6626672 ATATGTCATGGGAGTGTTGGGGG - Intronic
1036584801 8:10113446-10113468 ACCTGTAATGGGAGGGTAGGAGG + Intronic
1037026897 8:14050050-14050072 ATCTGTCATTGGAGGTTGTGGGG - Intergenic
1037544904 8:19910176-19910198 GCCTGTCATGGGAGGGTGGAGGG - Intronic
1038696259 8:29809373-29809395 ATGTGTAATAGGAGGCTGTGAGG + Intergenic
1039617751 8:38969791-38969813 CAGTGCCATGGGAGGGAGGGAGG + Exonic
1039768509 8:40658476-40658498 ATGGGGCATGGGGGGTTGGGAGG + Intronic
1039856433 8:41418855-41418877 ATGGGTGGTGGGAGGATGGGAGG + Intergenic
1039860587 8:41453788-41453810 ATTGGGCATGGGAGGGAGGGAGG - Intergenic
1040308280 8:46223512-46223534 GTGTGGCATGGGAGGGTCGCAGG + Intergenic
1040324964 8:46337057-46337079 ACGTGGCATGGGAGGGTTGCAGG + Intergenic
1041804639 8:61836745-61836767 CTCTGTCTAGGGAGGGTGGGGGG + Intergenic
1042192266 8:66198916-66198938 ATGTGTGAGGTGGGGGTGGGTGG - Intergenic
1042427225 8:68662138-68662160 ATGGGTTATGGGAGGGTGCTGGG + Intronic
1043660741 8:82736922-82736944 ATGAGTTGTGGGAGGGTTGGTGG + Intergenic
1043935415 8:86136989-86137011 ATGTGTCCTTTTAGGGTGGGAGG - Intronic
1044785261 8:95786768-95786790 ATGTTTCAAGGAAGGGAGGGAGG + Intergenic
1045497356 8:102719697-102719719 ATGAGTCCTGGGTGAGTGGGAGG + Intergenic
1045506018 8:102779346-102779368 ATCTGTCCTGGGAGGGCAGGCGG + Intergenic
1045535925 8:103027835-103027857 GTGTGTGCAGGGAGGGTGGGAGG - Intronic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1046507559 8:115155454-115155476 ATGTTTCATGGGGCGGAGGGGGG + Intergenic
1046521617 8:115332962-115332984 ATGTGTGATGTGTGTGTGGGGGG + Intergenic
1046687362 8:117242508-117242530 TTGTGGGATGGGTGGGTGGGAGG - Intergenic
1046717747 8:117585992-117586014 ATGTGGCATAGGAGGGGAGGGGG + Intergenic
1048205722 8:132413886-132413908 ATTTGTCATGGGTGGGCGTGCGG - Intronic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1049734870 8:144199574-144199596 GTGGGTCATGGGAGGCTGGCAGG - Intronic
1052369871 9:27651924-27651946 AGGTGGCATGAGTGGGTGGGTGG + Intergenic
1052716841 9:32128240-32128262 ATATAACATGGGAGGGTGCGGGG + Intergenic
1053113792 9:35484609-35484631 ATGTGTCATGGGGGTGGGTGGGG - Intergenic
1055623584 9:78150303-78150325 AAGTGTCATGGAAGAGTGAGTGG + Intergenic
1056809063 9:89750254-89750276 CTGTGTCAAGCGAGGGGGGGGGG + Intergenic
1057036708 9:91816690-91816712 GTGTGTGTTGGGGGGGTGGGGGG - Intronic
1057569163 9:96190686-96190708 ATGGGTAATGGTTGGGTGGGAGG - Intergenic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1058633424 9:107012737-107012759 AAGGGTTGTGGGAGGGTGGGAGG + Exonic
1059252165 9:112895570-112895592 ATGGATGATGGGTGGGTGGGTGG - Intergenic
1059252177 9:112895613-112895635 ATGAATGATGGGTGGGTGGGTGG - Intergenic
1059252194 9:112895676-112895698 ATGGATGATGGGTGGGTGGGTGG - Intergenic
1059267838 9:113052274-113052296 ATGGGTCATGGCAGGGAGAGGGG - Intronic
1059639233 9:116200337-116200359 ATGTGTTATGATAGAGTGGGTGG - Intronic
1059965130 9:119606254-119606276 ATGTGTCAGGGGTGGGGGGCTGG - Intergenic
1060495371 9:124114672-124114694 ATGTTACCTGGGTGGGTGGGGGG - Intergenic
1060828733 9:126700837-126700859 ATGTGTCTGGGGATGGCGGGTGG - Exonic
1061296643 9:129680471-129680493 AGGTGTCTAGGGCGGGTGGGGGG - Intronic
1061864507 9:133485422-133485444 CCGTGTCTTGGGAAGGTGGGAGG + Intergenic
1062189074 9:135238050-135238072 TTGTGTCCTGGGAAGCTGGGAGG - Intergenic
1062649920 9:137570129-137570151 ATGGGTGGTGGGTGGGTGGGTGG - Intronic
1185611438 X:1395700-1395722 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185611529 X:1396204-1396226 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185666188 X:1767236-1767258 ATCTGTGATGGGAGAGTGGGAGG + Intergenic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1186216810 X:7309387-7309409 ATTTGAGAGGGGAGGGTGGGAGG + Intronic
1186752742 X:12638601-12638623 AGGTGTGGTGGGTGGGTGGGTGG - Intronic
1186846424 X:13535248-13535270 ATGTGTCATGATAGGGTGAATGG - Intergenic
1187833952 X:23411869-23411891 ATGGGTAGTGGGAGGGTGGCGGG + Intergenic
1188228014 X:27625854-27625876 ATTTGTGAGTGGAGGGTGGGAGG + Intronic
1188807983 X:34614871-34614893 AGGTGTTGAGGGAGGGTGGGAGG - Intergenic
1189417233 X:40825981-40826003 GTGGGTCATTGTAGGGTGGGGGG + Intergenic
1189457650 X:41207846-41207868 ATGAGAGATGGGAGGGAGGGTGG - Intronic
1189545625 X:42039827-42039849 ACTTGACAAGGGAGGGTGGGAGG - Intergenic
1190212430 X:48459198-48459220 ATGGGTCCTGGGAAGGTGGAAGG - Intronic
1190399204 X:50014722-50014744 CTATGACAGGGGAGGGTGGGAGG - Intronic
1190732364 X:53234344-53234366 GGGTGTGAGGGGAGGGTGGGGGG + Exonic
1191075163 X:56445144-56445166 ATGTGTCTAGGGAGGATGGAAGG + Intergenic
1191674429 X:63779526-63779548 ATGTGTCATGGGAGGGACCTGGG - Intronic
1191794535 X:65006551-65006573 GTCTGTCATGGGGTGGTGGGAGG + Intronic
1192169419 X:68844950-68844972 AAGAGATATGGGAGGGTGGGAGG + Intergenic
1192775313 X:74238525-74238547 CTGTGTCCTTGGAGTGTGGGTGG - Intergenic
1192797894 X:74439689-74439711 ATGTGTGGTGGGGGAGTGGGGGG + Intronic
1193779294 X:85683246-85683268 ATATGTCCAGGAAGGGTGGGTGG + Intergenic
1193799477 X:85917289-85917311 ATGGGTCAAGGGAGGCTGGGAGG + Intronic
1193838097 X:86371857-86371879 ATGTCTGATGGGAGGTGGGGAGG + Intronic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1195428377 X:104761404-104761426 ATGTGTCATGGGAGGGACCTGGG - Intronic
1195433849 X:104819490-104819512 TTATATCATGGGAGGATGGGAGG + Intronic
1195838712 X:109148964-109148986 ATGTGTCATGGGAGGGACCCGGG + Intergenic
1196124025 X:112081250-112081272 GTGTGTCTAGGGAGGGAGGGAGG + Intronic
1196622942 X:117844472-117844494 ACCTGTCATGGGATGGGGGGAGG + Intergenic
1197090822 X:122534484-122534506 AAGAGTAATGGGAGGTTGGGGGG + Intergenic
1197746958 X:129938061-129938083 ATGTCTCCTGGGTGGGGGGGTGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1199739425 X:150719223-150719245 TTGTGCCATGGGTGGATGGGAGG + Intronic
1200052133 X:153439500-153439522 GTGTGTCAGGGGAGTGTGTGTGG + Intergenic
1200116701 X:153772690-153772712 ATGCGGCAGGGGTGGGTGGGAGG + Intronic
1200149990 X:153946678-153946700 CTGTGTCATGTGGGGGTGGGGGG - Intergenic
1200345167 X:155440495-155440517 ATGTGTCATGGGAGGGACCAGGG - Intergenic
1200359126 X:155583458-155583480 ACATGTTGTGGGAGGGTGGGAGG - Intronic
1201158405 Y:11151995-11152017 AGGGGTCATGTGTGGGTGGGTGG - Intergenic
1201942810 Y:19477942-19477964 ATGTACCATGGGAGGGAGTGGGG + Intergenic