ID: 989089872

View in Genome Browser
Species Human (GRCh38)
Location 5:37719147-37719169
Sequence GGCCATCTGGGAATTTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989089868_989089872 -7 Left 989089868 5:37719131-37719153 CCATATACCTGGCTGTGGCCATC 0: 1
1: 0
2: 0
3: 16
4: 152
Right 989089872 5:37719147-37719169 GGCCATCTGGGAATTTCCAGTGG 0: 1
1: 1
2: 0
3: 22
4: 165
989089866_989089872 3 Left 989089866 5:37719121-37719143 CCTTATGTTTCCATATACCTGGC 0: 1
1: 0
2: 3
3: 6
4: 139
Right 989089872 5:37719147-37719169 GGCCATCTGGGAATTTCCAGTGG 0: 1
1: 1
2: 0
3: 22
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989089872 Original CRISPR GGCCATCTGGGAATTTCCAG TGG Intronic
902217800 1:14945462-14945484 CGCCATCTGGGATTTTTCAGAGG - Intronic
904252160 1:29232779-29232801 GGCCATCTGGGTTCTTGCAGGGG + Intergenic
904342288 1:29844602-29844624 GTCCATCAGGAAATTTCCAAAGG + Intergenic
904399921 1:30249353-30249375 GTCCATCAGGAAATTTCCAAAGG - Intergenic
904452448 1:30622577-30622599 GTCCCTTTGGAAATTTCCAGTGG + Intergenic
905474582 1:38217283-38217305 GGCTACCTGGGACCTTCCAGAGG + Intergenic
907385960 1:54125436-54125458 GGCCATCTGGGAAGTGCATGTGG + Intergenic
907481811 1:54750135-54750157 GGCCTTCTGGCATATTCCAGGGG + Intergenic
908632177 1:66121252-66121274 GGCCATCAGGAATTTTGCAGTGG + Intronic
910285076 1:85544855-85544877 GGCCCTTTGGGAATTTTAAGGGG - Intronic
910795489 1:91093361-91093383 GGCCACATGGGAATTTTCTGGGG - Intergenic
911984388 1:104602234-104602256 GGCCATATGGGAACTTAGAGTGG - Intergenic
912902529 1:113668022-113668044 GAAGACCTGGGAATTTCCAGTGG + Intronic
913195899 1:116455537-116455559 GCCCAACTGGGAGTTTCCAGAGG + Intergenic
916617007 1:166452259-166452281 GGCCATCTGGGATTTTCCAGAGG + Intergenic
917646526 1:177034068-177034090 GGCCCTCTGGGAATTAGTAGCGG - Intronic
920200186 1:204255426-204255448 GGACAGCTGGGAGTTTCCTGGGG - Intronic
923022118 1:230173217-230173239 GGGCATCTAGGTCTTTCCAGAGG + Intronic
923991224 1:239439235-239439257 GACCACCTGGGATATTCCAGGGG - Intronic
1064030243 10:11879028-11879050 GGCCATGTAGGAATTCCCTGCGG - Intergenic
1067513012 10:46911232-46911254 GGCCCGCAGGGAATTTACAGCGG + Intergenic
1067541638 10:47159306-47159328 GCCCATCTGGGCATTCCCTGTGG - Intergenic
1067649236 10:48140590-48140612 GGCCCGCAGGGAATTTACAGCGG - Intergenic
1067777293 10:49172815-49172837 GGGCATCTGCCAATTTCTAGGGG + Intronic
1069278335 10:66621231-66621253 GGCCATATTGGAATCTCCTGAGG - Intronic
1071493176 10:86150515-86150537 AGCCACATGTGAATTTCCAGGGG + Intronic
1072056775 10:91766138-91766160 GGTCATCGGGGAAATTTCAGGGG + Intergenic
1072705747 10:97679716-97679738 GATCATCTGGGAATGTGCAGGGG - Exonic
1073127306 10:101159357-101159379 GGGTGTCTGGGAACTTCCAGAGG + Intergenic
1074499006 10:114005459-114005481 GGCCATCTGTGGCTTCCCAGTGG + Intergenic
1074761214 10:116668822-116668844 GAACATCTGGCAATGTCCAGAGG + Intronic
1075547968 10:123369796-123369818 GGACATGAGGGAGTTTCCAGGGG + Intergenic
1076448321 10:130534528-130534550 TGCCATCTGGAAATGTCCTGTGG + Intergenic
1076771966 10:132670657-132670679 GGCCTTCTGGGAGGTCCCAGTGG + Intronic
1077517308 11:3009723-3009745 GACCATGGGGGTATTTCCAGGGG + Intronic
1077652385 11:3984910-3984932 GGTCCTGTGGGAGTTTCCAGAGG + Intronic
1078367899 11:10721851-10721873 GGCCATCTGGGAACTGCCGGTGG - Intergenic
1083285967 11:61659127-61659149 GGCCATTTTGGAGTTTCCATTGG - Intergenic
1083709321 11:64538572-64538594 GGCCATCTGGGACGTTGCTGTGG + Intergenic
1083815936 11:65132489-65132511 GGCCCTCTGGGAACTTCCTGGGG + Intronic
1084442288 11:69181485-69181507 TGCCATCTGGGGCTTTCCAATGG + Intergenic
1084903177 11:72325459-72325481 GGCCCCCTGAGAATATCCAGAGG - Intronic
1089852199 11:121509067-121509089 TGACATCTGGGATATTCCAGGGG - Intronic
1092564529 12:9650228-9650250 GGACATGAGGGAATTTCGAGTGG - Intergenic
1093203305 12:16215860-16215882 AGCCCTCAGGAAATTTCCAGGGG - Intronic
1093236910 12:16620790-16620812 TGCTATCTGGTAATATCCAGGGG - Intergenic
1094288512 12:28819727-28819749 GACCAACTGGAAACTTCCAGAGG - Intergenic
1097338015 12:58406510-58406532 CGCCATCTTGGAATTTACTGTGG + Intergenic
1098740896 12:74171798-74171820 GGCCGTCTGGGATTGTTCAGGGG - Intergenic
1104213894 12:126716860-126716882 GGACATCTGGAAACTTCCATAGG + Intergenic
1109374291 13:61469689-61469711 GTCCATCTGGGAATGTGAAGTGG - Intergenic
1111904625 13:94240853-94240875 GGCCAGCTGGGAAGCTCCTGAGG + Intronic
1113743131 13:112724791-112724813 TGCCATGTGGGAAATTCCAAGGG + Intronic
1119434907 14:74592187-74592209 GGCCATCTCAGAATCTCCAGTGG + Intronic
1121485830 14:94313659-94313681 GGGCATCTGGGAGTTCCCAAGGG + Intronic
1121628892 14:95408434-95408456 TGTCATCTGGGAATTTCCTTGGG - Intronic
1123626498 15:22230312-22230334 GGCCTTCTGGAAGTTTTCAGGGG + Intergenic
1127308755 15:57732667-57732689 GGCCATCCAGGAGTTTCCATAGG + Intronic
1127641309 15:60918358-60918380 GGCCATTAGTGAATTTCCAGTGG + Intronic
1129516983 15:76162949-76162971 GACCTTCTTGGAATTTCCTGTGG - Intronic
1130698763 15:86157797-86157819 GGCCATCTGAGAACTTCCAAAGG - Intronic
1131059378 15:89395265-89395287 GCCCATCTGGGACTTGGCAGGGG + Intergenic
1131737229 15:95346765-95346787 GGCAAGCTTGGAATTGCCAGGGG + Intergenic
1132975285 16:2708024-2708046 AGCCCTGTGGGCATTTCCAGAGG - Exonic
1135388937 16:22071996-22072018 GGCCATTTTGGGGTTTCCAGTGG + Intronic
1136221194 16:28830089-28830111 GGGCTTCTGGGAATATCCTGGGG + Intronic
1139558458 16:67727387-67727409 GGCCAACTGGGCAGCTCCAGGGG + Exonic
1140277956 16:73527718-73527740 GGCCTTCTGGGCCTTTCCACAGG - Intergenic
1141552730 16:84816925-84816947 TCCCATCTGGGACTTCCCAGGGG + Intergenic
1141648692 16:85380861-85380883 GGGGAGCTGTGAATTTCCAGTGG + Intergenic
1141814276 16:86399151-86399173 GTACATCTGGGAATATTCAGAGG + Intergenic
1143163791 17:4887449-4887471 GGCCACCTGGGAGTGGCCAGAGG + Intronic
1146329697 17:31917239-31917261 GGCCTTCTGGGGTTTTCCCGCGG + Intergenic
1150613199 17:66749720-66749742 GGCCACCTAGGAATCTGCAGGGG + Intronic
1150725633 17:67649291-67649313 GCCCATCTGGAAATTTCTAAAGG + Intronic
1154401646 18:14043702-14043724 GGCCATCTTGGAACCTCAAGAGG + Intergenic
1156811914 18:41263090-41263112 AGCTAACTGGGAACTTCCAGAGG + Intergenic
1157003918 18:43559535-43559557 TGCCATCTGGGTGTTTCCTGGGG + Intergenic
1158276571 18:55774946-55774968 TGACATCTGGGAATTCCCAAGGG - Intergenic
1158343654 18:56492579-56492601 GGGCATGTGGGAACTTCCTGGGG - Intergenic
1161097130 19:2398900-2398922 GGACATCTGGGAGTTTCTGGAGG + Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1163698261 19:18774789-18774811 TGCCGTCTGGGAGGTTCCAGGGG + Intronic
1164789954 19:30968381-30968403 GGCCATCTGGCAACCACCAGAGG + Intergenic
1167049665 19:47070748-47070770 GGCCATGTGGAAATTTTGAGGGG - Intronic
926283586 2:11469763-11469785 GGCCCACAGGGAATTTCCTGTGG - Intergenic
928075008 2:28256467-28256489 GGGCATCTGGGAATTTGGATGGG - Intronic
930881838 2:56279031-56279053 GGCCAGCTGTGATTTGCCAGGGG + Intronic
931247501 2:60503658-60503680 GGCCATCTGGGTGTTTGCTGAGG - Intronic
932247004 2:70204486-70204508 AGCCACCTGGAAATTTCCAAAGG + Intronic
932563534 2:72891925-72891947 GGCCATCTGCGAATCTACATGGG - Exonic
932709741 2:74053717-74053739 GTCCATCAGGGAATTTCAAATGG + Intronic
932953379 2:76320416-76320438 GGCCATGTTGGATTTCCCAGGGG + Intergenic
933710071 2:85318674-85318696 CGCCAGCAGGGAAATTCCAGAGG + Intronic
935123472 2:100202043-100202065 GGCCACATGGGAAGTACCAGGGG - Intergenic
937152738 2:119697010-119697032 GGCCATGTGAGAATTTCCCCAGG - Intergenic
938123384 2:128650498-128650520 GTCCAACTGGGAATCTTCAGGGG - Intergenic
940988631 2:160075267-160075289 GGACATCTGGAAATCACCAGGGG + Intergenic
942329406 2:174806177-174806199 GTTCATCAGGGAGTTTCCAGGGG + Intronic
945440982 2:209879282-209879304 AGCCATCCTGGAACTTCCAGGGG + Intronic
946624910 2:221600747-221600769 GGACATTTAGGAATTTCCTGAGG + Intergenic
947858150 2:233338442-233338464 TGCCCTCTGGGAACTTCTAGAGG + Intronic
1172179296 20:32991116-32991138 GGCCATCAGGGAAATTCCTTAGG - Intronic
1174337251 20:49871742-49871764 GGCCATCTGGACAATCCCAGAGG - Intronic
1174745417 20:53057397-53057419 GGGCGTCTGGGAAATTTCAGTGG - Intronic
1176989134 21:15473215-15473237 GGACATTTGGGAATTTCTAGAGG - Intergenic
1179159845 21:38885630-38885652 TGCCAACTTTGAATTTCCAGGGG + Intergenic
1179494391 21:41762474-41762496 GCACATCTGGGAAACTCCAGCGG + Intronic
1179561013 21:42216288-42216310 TGACAGCTGGTAATTTCCAGTGG - Intronic
1180097802 21:45567891-45567913 TGCCACCTGGGACTCTCCAGAGG - Intergenic
1180171468 21:46060899-46060921 GGTCCTCTGGGGATTTCCAGTGG + Intergenic
1181445893 22:22973920-22973942 AGCCATCTGGTCACTTCCAGAGG + Intergenic
1182062868 22:27410443-27410465 GGCCAGCCGGGGATTTGCAGAGG + Intergenic
1182298938 22:29327366-29327388 TGCCATCTGGGAGGCTCCAGGGG - Intergenic
1184885931 22:47344523-47344545 GGACCTCTGGGATTTTACAGAGG + Intergenic
1185044244 22:48520963-48520985 AGCCACCTGGGCTTTTCCAGGGG - Intronic
949594855 3:5532671-5532693 TGCCATCTGGGTATTTCCCAGGG + Intergenic
949896167 3:8768776-8768798 GGCTATTTGGGGATTTCCGGAGG - Intronic
957583230 3:82103681-82103703 GGCCATCTGGGTATATTCATTGG + Intergenic
959330226 3:104996199-104996221 GGCAATTTGGGAAGTTCCTGGGG + Intergenic
962623700 3:137203848-137203870 GGGCATTTGGGAATGTGCAGAGG + Intergenic
962909993 3:139839248-139839270 AGCCATATGGAACTTTCCAGTGG + Intergenic
963807603 3:149740918-149740940 GGCCATCTGGCTAGTTCCAACGG + Exonic
964050562 3:152388308-152388330 GTCCATTTGGGAATTTACAAAGG + Intronic
964838823 3:160971381-160971403 GGTCATCTGAGCATTTCTAGTGG - Intronic
964839475 3:160978305-160978327 TGGCATCAGGGAATCTCCAGGGG + Intronic
966731102 3:183152050-183152072 GGCCCACTGGGAATTTCTACAGG + Intronic
966894026 3:184428764-184428786 GGCCAGCTGGGAACCTCCAGTGG - Intronic
967846897 3:194051468-194051490 GGCCATGTGGGAATGGCCATGGG - Intergenic
968747220 4:2366357-2366379 GACCATCTGGGAAACTGCAGAGG - Intronic
971474470 4:27059101-27059123 AGAGATCTGGGAATTTCCATAGG - Intergenic
974762372 4:66294160-66294182 GGTTATCAGGGAATTTCCAGTGG + Intergenic
976129885 4:81872311-81872333 GGCCAAATGAGACTTTCCAGGGG - Intronic
984865359 4:184275961-184275983 AGCCAGCTGGGAATTTCCATGGG + Intergenic
985692794 5:1323001-1323023 GAGCATCTGGGTATTTTCAGAGG - Intronic
985777510 5:1852497-1852519 GGCCATCTGGCATGTCCCAGAGG + Intergenic
985818228 5:2142570-2142592 GGCAAGATGGGAATGTCCAGAGG - Intergenic
989089872 5:37719147-37719169 GGCCATCTGGGAATTTCCAGTGG + Intronic
994495738 5:100510739-100510761 GGCAATGTGGGAATTTTCAAGGG + Intergenic
995105966 5:108379021-108379043 GGACATATGGGAATTACCATGGG - Intronic
995749778 5:115441904-115441926 GGCCATCTTGGAACCTCCAAGGG - Intergenic
999147771 5:149407115-149407137 GGGCCTCTGGGAATTTCCCTAGG + Intergenic
1004717109 6:18228386-18228408 GGCCATCTTGGAACCTCCCGGGG - Intronic
1007523904 6:42474278-42474300 GGCACTGTGGGAATTTACAGAGG + Intergenic
1012175452 6:96076353-96076375 GGTAATCTGGGAATTACCTGAGG + Intronic
1012926785 6:105275215-105275237 GGCCTGCTGGGAACTTCCAGAGG + Intergenic
1013138288 6:107304282-107304304 GGTTATCTGGGAGTTGCCAGAGG + Intronic
1015676852 6:135760419-135760441 GGGCATGAGGGAATTTCCTGGGG - Intergenic
1016137309 6:140560412-140560434 TGCCATCTGGAAAATTCCTGTGG + Intergenic
1017985743 6:159441855-159441877 GGCCATCTGGGGTCTTCCAGAGG - Intergenic
1018607952 6:165618410-165618432 AGGCATTTGGGAATTTCCAGAGG + Intronic
1019958741 7:4438349-4438371 GGCCATCTGGGACTTTTCAAAGG - Intergenic
1021101693 7:16591724-16591746 GTGTACCTGGGAATTTCCAGAGG - Intergenic
1021360006 7:19701140-19701162 GACCATCTGGAAACTACCAGTGG - Intronic
1023265665 7:38403387-38403409 GGCAATCTGAGAACTTCCTGAGG + Intronic
1023420349 7:39972977-39972999 AGCCATCTTGGTATTTGCAGTGG + Intronic
1024486612 7:49926895-49926917 GGCTATGTGAGAATTTCCTGCGG - Intronic
1025000372 7:55310904-55310926 GGACATTTGGCAATGTCCAGTGG - Intergenic
1028078773 7:86548217-86548239 CCTCATCTGGGAATTGCCAGGGG - Intergenic
1030424681 7:109359576-109359598 GGACATAAGGGAATTTTCAGTGG - Intergenic
1030641384 7:112010449-112010471 AGCCACCTGGGAGTTCCCAGCGG - Intronic
1030889072 7:114975388-114975410 GACCATCTGGCATTTTTCAGAGG - Intronic
1031026561 7:116686014-116686036 GGCCAGCTGGGAGGCTCCAGTGG - Intronic
1031072381 7:117176345-117176367 TGCCATCTGGTAATTTGCAGAGG + Intronic
1031903833 7:127439522-127439544 GACCATCTGGGGATTGCAAGAGG - Intergenic
1032650461 7:133872466-133872488 GACCATCTGGAAATCTCTAGTGG + Intronic
1035318404 7:158012686-158012708 GGTGACCTGGGAATTTCAAGAGG - Intronic
1036969726 8:13341553-13341575 GGCCACCTGGGAATTCTCAAAGG - Intronic
1038452775 8:27650555-27650577 GGCCAAATAGGAATTTCCAAGGG - Intronic
1041594120 8:59626191-59626213 GTACATCTGGGATTTTACAGTGG - Intergenic
1049282829 8:141759262-141759284 GGCCCTCTGGGAAATTCCTGGGG + Intergenic
1050361614 9:4836185-4836207 GGCCATGTGGCTATATCCAGTGG + Intronic
1055077758 9:72234282-72234304 GGCCATGAGGGAATTTGCTGGGG + Intronic
1055232038 9:74077752-74077774 GGCAATTTGGGAACTTCCTGGGG + Intergenic
1056126880 9:83543427-83543449 GGCAATTTGGGAATTTCTTGAGG + Intergenic
1056718938 9:89056994-89057016 GTCCATCTGGGGTTCTCCAGTGG + Intronic
1057280444 9:93707548-93707570 GGCCAGCTGGGAATGTCGACTGG + Intergenic
1059510528 9:114840894-114840916 GGCATTCTGTGAATTTCCTGAGG - Intergenic
1060144493 9:121239850-121239872 TGCCATCTAGTAATGTCCAGTGG + Intronic
1061922698 9:133790936-133790958 GACCCTCTGGTAATGTCCAGAGG + Intronic
1062586288 9:137251426-137251448 GGCCAGCTGGGAGTGGCCAGGGG + Intronic
1185842974 X:3410433-3410455 GGCCATCTGGGAATTCCAGGGGG - Intergenic
1186529420 X:10280153-10280175 GGCCATCTTGGTACTTCCAGGGG - Intergenic
1187439789 X:19307616-19307638 GGACATAGGGGAATTACCAGGGG - Intergenic
1192707506 X:73541727-73541749 GCCCACCTGGGTATTACCAGTGG - Intergenic
1194822336 X:98524628-98524650 GGCCATCTGGGCATATACAGTGG + Intergenic
1196084298 X:111667837-111667859 GGCCCTCTGAGAAATTTCAGTGG + Intronic
1196772796 X:119311511-119311533 GGCCATGTGGGAATGTCTGGGGG - Intergenic
1201232216 Y:11876142-11876164 GGCCATCTGGGAATTCCAGGGGG + Intergenic