ID: 989094733

View in Genome Browser
Species Human (GRCh38)
Location 5:37771360-37771382
Sequence GGGACATGGGGCTGTGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989094725_989094733 3 Left 989094725 5:37771334-37771356 CCCAGACTAAAGGTACTGACTGT No data
Right 989094733 5:37771360-37771382 GGGACATGGGGCTGTGCTGAGGG No data
989094724_989094733 4 Left 989094724 5:37771333-37771355 CCCCAGACTAAAGGTACTGACTG No data
Right 989094733 5:37771360-37771382 GGGACATGGGGCTGTGCTGAGGG No data
989094723_989094733 7 Left 989094723 5:37771330-37771352 CCACCCCAGACTAAAGGTACTGA No data
Right 989094733 5:37771360-37771382 GGGACATGGGGCTGTGCTGAGGG No data
989094726_989094733 2 Left 989094726 5:37771335-37771357 CCAGACTAAAGGTACTGACTGTG No data
Right 989094733 5:37771360-37771382 GGGACATGGGGCTGTGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989094733 Original CRISPR GGGACATGGGGCTGTGCTGA GGG Intergenic