ID: 989099749

View in Genome Browser
Species Human (GRCh38)
Location 5:37812799-37812821
Sequence CCAAACAAGTGCACTCCTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989099747_989099749 5 Left 989099747 5:37812771-37812793 CCAAGACAGATCAGAGAAGTCAG 0: 1
1: 0
2: 2
3: 33
4: 261
Right 989099749 5:37812799-37812821 CCAAACAAGTGCACTCCTTACGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989099749 Original CRISPR CCAAACAAGTGCACTCCTTA CGG Intronic
904434232 1:30483900-30483922 CCAGCCACGTGCACTCCATAAGG + Intergenic
906118679 1:43372885-43372907 CTAAACTGGTACACTCCTTATGG - Intergenic
906827871 1:49001071-49001093 CCAAATTAGTGTACTGCTTAGGG + Intronic
908334172 1:63103482-63103504 AGAAAGAAGTGCACTCCTTTAGG - Intergenic
910027938 1:82680823-82680845 CCAAAAAAGTGCATTCCTTCTGG - Intergenic
911331949 1:96534853-96534875 CCAAACAGATGCATTCATTAAGG + Intergenic
911541878 1:99166138-99166160 TCAAGAAAGAGCACTCCTTAAGG - Intergenic
913445505 1:118946454-118946476 TCAAACCAGTGTAGTCCTTAAGG - Intronic
916355324 1:163899566-163899588 CCAGACAAATGCACTTTTTAGGG - Intergenic
917226491 1:172789045-172789067 CCAAAGAATTGCAGTCCTTGTGG + Intergenic
918918162 1:190671373-190671395 CACAACCAGTGCACTCCTCAAGG + Intergenic
918958301 1:191238437-191238459 ACAAACAGGTGCACTGCTTGAGG - Intergenic
919056617 1:192578672-192578694 CAAAACAAGAGCACTCATTAAGG - Intronic
920725146 1:208428056-208428078 CCCAACAAGTCCCCTCCTCAGGG - Intergenic
920792318 1:209104917-209104939 TCAAACAACTGCCCTCCTGATGG + Intergenic
1067798908 10:49343216-49343238 CCTAAGAATTGCAGTCCTTATGG - Intergenic
1070163490 10:73880643-73880665 CCAAACAAGAGCATTCCTGGTGG + Intergenic
1071470683 10:85982049-85982071 CCAAACAAGCGCTCACCTCAGGG - Intronic
1071858420 10:89648481-89648503 ACAAACCAGTGCACTCCCTTGGG + Intergenic
1075240604 10:120775085-120775107 CCAAAAAAATGCAGTCCTAAGGG - Intergenic
1080796378 11:35567546-35567568 CCAAGGAACTGCAGTCCTTATGG - Intergenic
1081278208 11:41177147-41177169 CCAGACATATCCACTCCTTAAGG - Intronic
1081531013 11:43959427-43959449 CCAAACCAGTGCATTCCTGCTGG + Intergenic
1085572209 11:77569302-77569324 CCCAGCAATTGCAATCCTTAGGG + Intronic
1086006608 11:82046072-82046094 CCTAAGAATTGCAGTCCTTATGG - Intergenic
1086395073 11:86406974-86406996 ACAAACCAGTGCAGTCCTTCAGG - Intronic
1095286004 12:40411198-40411220 CCAAAAAAGACCACTTCTTAAGG - Intronic
1095741070 12:45607866-45607888 CCATTCAAGTTCACACCTTATGG + Intergenic
1101569609 12:105941036-105941058 CCAAACAAGCTCCCTCCTTATGG + Intergenic
1105950587 13:25226060-25226082 TGAAACAAGTGCACACGTTATGG - Intergenic
1106916675 13:34522928-34522950 ACAAAAATGTGAACTCCTTAAGG - Intergenic
1120109777 14:80540427-80540449 CCACACAGGTGCCCTCCTTAGGG - Intronic
1121229487 14:92346100-92346122 ACAAACACGTGCCCTCCTCAGGG - Intronic
1125087313 15:35745410-35745432 ACAAACAAGTGTATTCCTCAAGG - Intergenic
1142877157 17:2858191-2858213 GAAAACAAGTCCACTTCTTATGG + Intronic
1149319942 17:55472479-55472501 CCTAATAAGGGCCCTCCTTAAGG + Intergenic
1149485658 17:57040880-57040902 CAAAACAGGTGCCCTCCTGAAGG - Intergenic
1153580839 18:6571711-6571733 CCAAATAAGTGCCTTCCTTCAGG + Intronic
1153903163 18:9636941-9636963 CAAGACAAGTACACTCCTTTAGG + Intergenic
1155227002 18:23737629-23737651 CCAAGTAAGTGGAATCCTTAGGG + Intronic
1157896858 18:51477733-51477755 CCAAGCAAGTGCATTTCTCAAGG - Intergenic
928105109 2:28465207-28465229 GCAACCAAGTGCAATCCTGATGG - Intronic
937617496 2:123943631-123943653 CCTAAGAATTGCATTCCTTATGG - Intergenic
938815664 2:134901538-134901560 CCAAACAAGGGCACCTCCTAAGG + Intronic
948179244 2:235966638-235966660 TCAACCATGTGCACTCCTTGTGG - Intronic
948366323 2:237457317-237457339 CCAAACAAGTGCTCTACAAATGG + Intergenic
1170538959 20:17369148-17369170 CCAAGAAAGTGCCCTCTTTATGG - Intronic
1171129287 20:22634165-22634187 CCAAACAGGTGCTCACCTCAGGG - Intergenic
1172217756 20:33248324-33248346 CCAGAGACGTGCACTCCTTAGGG + Intergenic
951403660 3:22266721-22266743 CCAAACAAGAGTACTGCTTTGGG - Intronic
953761566 3:45691404-45691426 CCAAAAAAGAATACTCCTTAGGG - Intronic
956161630 3:66360664-66360686 CAAAACATGTGAACTACTTAAGG + Intronic
959413943 3:106061379-106061401 CCTAAGAATTGCAGTCCTTATGG - Intergenic
962976597 3:140451403-140451425 CCAAATAAGTCCACACCTTGGGG - Intronic
966303458 3:178504336-178504358 CCAAACAAGCTCATTCCTCATGG - Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
970627134 4:17898903-17898925 ACAAACTGGTGCAGTCCTTATGG - Intronic
973571280 4:52242185-52242207 CCAAACAAGTCCACTTATGATGG - Intergenic
974101245 4:57419815-57419837 GCTAACAAGTGCTCTCTTTAGGG + Intergenic
982486815 4:155976324-155976346 CCAGACAATTGCATTCCTTTTGG - Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
986028956 5:3877510-3877532 CCAAACAAATGCAATCATTTGGG + Intergenic
989099749 5:37812799-37812821 CCAAACAAGTGCACTCCTTACGG + Intronic
993932284 5:93954727-93954749 CCCAAGAATTGCAGTCCTTATGG + Intronic
996161543 5:120173272-120173294 CCTAAGAATTGCAGTCCTTACGG - Intergenic
1000104040 5:158041801-158041823 CCACCCAAGTGCACTCCATATGG - Intergenic
1003128220 6:3373109-3373131 CCAAGCAAGTGCTTTCCTTCTGG + Intronic
1004431831 6:15552023-15552045 ACAAACAAGTACAATCCTCATGG + Intronic
1005786213 6:29248303-29248325 CCTAACAAAGGCCCTCCTTAAGG - Intergenic
1005857179 6:29871536-29871558 CAAAACAAGGGCACTCCAGAAGG + Intergenic
1007871393 6:45043094-45043116 CCAGAAAAGTGTACTTCTTATGG - Intronic
1008155233 6:48006016-48006038 CCAAACAAATGCCCCCTTTATGG + Intronic
1009300556 6:62012615-62012637 CCAAGCAAGTGCCTTCCTTTTGG + Intronic
1019812739 7:3176507-3176529 CCAAACCAGGGCACTGCTTGAGG - Intergenic
1021791215 7:24207801-24207823 CCAAATAGGTCCCCTCCTTAGGG - Intergenic
1022557062 7:31308741-31308763 CCAACCAGGTTCACTCCTAAAGG - Intergenic
1023335694 7:39166806-39166828 CCAAGCAGGTGCACTTCTTGGGG + Intronic
1023605550 7:41927673-41927695 CCAAAGAAATGCACTCTCTAAGG - Intergenic
1024587119 7:50851562-50851584 CCAAACACAGACACTCCTTATGG + Intergenic
1026553326 7:71386019-71386041 CAAAACAAGAGCACTCCAGAGGG - Intronic
1030846860 7:114427515-114427537 TCAAACAAGTGTACTCATTCTGG - Intronic
1044395285 8:91703570-91703592 CCAAAGAGTTGCAGTCCTTATGG + Intergenic
1044863160 8:96542880-96542902 CCAAACCAGGGCACTCTTAAAGG - Intronic
1046448432 8:114356749-114356771 CCTAAGAATTGCAGTCCTTATGG - Intergenic
1050899868 9:10933659-10933681 CCAAACAAATGAACTCCTACAGG - Intergenic
1052258874 9:26491565-26491587 CCTAAGAATTGCAGTCCTTATGG + Intergenic
1057022528 9:91710776-91710798 ACAAATAATTGCACTCCTTGGGG + Intronic
1058226612 9:102371872-102371894 CCTAAAAATTGCAGTCCTTAGGG + Intergenic
1059943625 9:119383451-119383473 CCCAACAAGTGCTCTCTTTCTGG + Intergenic
1193204935 X:78736928-78736950 CCTAACAGTTGCAATCCTTATGG + Intergenic
1194591457 X:95804941-95804963 CCTAAGAGTTGCACTCCTTATGG - Intergenic
1195592201 X:106642449-106642471 TCAAACAAGTGAACTCATAAAGG - Intronic
1198125034 X:133635293-133635315 TCAAATAAGTGCTCTCCTTCTGG - Intronic
1199374340 X:147089015-147089037 CCTAAGAATTGCAGTCCTTATGG + Intergenic
1199539222 X:148940273-148940295 TCAAACAAATGCACATCTTAGGG - Intronic
1199804261 X:151282255-151282277 CCAAACAAATGCATTCCTACTGG - Intergenic
1201119794 Y:10864114-10864136 CCAAACAAATCCACTCCATTAGG + Intergenic