ID: 989102756 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:37836921-37836943 |
Sequence | AAAACTCCCCGCGTCGCCAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 38 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 35} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
989102753_989102756 | 22 | Left | 989102753 | 5:37836876-37836898 | CCTCAATTAGAAGTGTGGCGAAG | 0: 1 1: 0 2: 0 3: 1 4: 47 |
||
Right | 989102756 | 5:37836921-37836943 | AAAACTCCCCGCGTCGCCAGAGG | 0: 1 1: 0 2: 0 3: 2 4: 35 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
989102756 | Original CRISPR | AAAACTCCCCGCGTCGCCAG AGG | Intronic | ||