ID: 989102756

View in Genome Browser
Species Human (GRCh38)
Location 5:37836921-37836943
Sequence AAAACTCCCCGCGTCGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989102753_989102756 22 Left 989102753 5:37836876-37836898 CCTCAATTAGAAGTGTGGCGAAG 0: 1
1: 0
2: 0
3: 1
4: 47
Right 989102756 5:37836921-37836943 AAAACTCCCCGCGTCGCCAGAGG 0: 1
1: 0
2: 0
3: 2
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989102756 Original CRISPR AAAACTCCCCGCGTCGCCAG AGG Intronic