ID: 989103666

View in Genome Browser
Species Human (GRCh38)
Location 5:37841217-37841239
Sequence ATTCACATGGGGCATGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989103660_989103666 9 Left 989103660 5:37841185-37841207 CCTGTGCATGGCTATAACCATAA No data
Right 989103666 5:37841217-37841239 ATTCACATGGGGCATGGAATTGG No data
989103661_989103666 -8 Left 989103661 5:37841202-37841224 CCATAAATACATTTCATTCACAT No data
Right 989103666 5:37841217-37841239 ATTCACATGGGGCATGGAATTGG No data
989103658_989103666 19 Left 989103658 5:37841175-37841197 CCTTACACACCCTGTGCATGGCT No data
Right 989103666 5:37841217-37841239 ATTCACATGGGGCATGGAATTGG No data
989103659_989103666 10 Left 989103659 5:37841184-37841206 CCCTGTGCATGGCTATAACCATA No data
Right 989103666 5:37841217-37841239 ATTCACATGGGGCATGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989103666 Original CRISPR ATTCACATGGGGCATGGAAT TGG Intergenic
No off target data available for this crispr