ID: 989104591

View in Genome Browser
Species Human (GRCh38)
Location 5:37849612-37849634
Sequence CCACAGAGCGAGGCGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989104584_989104591 -3 Left 989104584 5:37849592-37849614 CCCTGGGAGCCTGGTAATTACCA No data
Right 989104591 5:37849612-37849634 CCACAGAGCGAGGCGGCAGAGGG No data
989104583_989104591 1 Left 989104583 5:37849588-37849610 CCAGCCCTGGGAGCCTGGTAATT No data
Right 989104591 5:37849612-37849634 CCACAGAGCGAGGCGGCAGAGGG No data
989104585_989104591 -4 Left 989104585 5:37849593-37849615 CCTGGGAGCCTGGTAATTACCAC No data
Right 989104591 5:37849612-37849634 CCACAGAGCGAGGCGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989104591 Original CRISPR CCACAGAGCGAGGCGGCAGA GGG Intergenic
No off target data available for this crispr