ID: 989105582

View in Genome Browser
Species Human (GRCh38)
Location 5:37860258-37860280
Sequence TGTACTTGGCTGTGACCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989105582_989105588 26 Left 989105582 5:37860258-37860280 CCCTGAGGTCACAGCCAAGTACA No data
Right 989105588 5:37860307-37860329 TGATACACTGTGTGTAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989105582 Original CRISPR TGTACTTGGCTGTGACCTCA GGG (reversed) Intergenic
No off target data available for this crispr