ID: 989106214

View in Genome Browser
Species Human (GRCh38)
Location 5:37865510-37865532
Sequence ACGTGTGCACACGTGTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989106214_989106215 -7 Left 989106214 5:37865510-37865532 CCTCTGCACACGTGTGCACACGT No data
Right 989106215 5:37865526-37865548 CACACGTGCACACACACAAATGG No data
989106214_989106217 3 Left 989106214 5:37865510-37865532 CCTCTGCACACGTGTGCACACGT No data
Right 989106217 5:37865536-37865558 CACACACAAATGGCACTTCTGGG No data
989106214_989106216 2 Left 989106214 5:37865510-37865532 CCTCTGCACACGTGTGCACACGT No data
Right 989106216 5:37865535-37865557 ACACACACAAATGGCACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989106214 Original CRISPR ACGTGTGCACACGTGTGCAG AGG (reversed) Intergenic