ID: 989106215

View in Genome Browser
Species Human (GRCh38)
Location 5:37865526-37865548
Sequence CACACGTGCACACACACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989106214_989106215 -7 Left 989106214 5:37865510-37865532 CCTCTGCACACGTGTGCACACGT No data
Right 989106215 5:37865526-37865548 CACACGTGCACACACACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989106215 Original CRISPR CACACGTGCACACACACAAA TGG Intergenic
No off target data available for this crispr