ID: 989106216

View in Genome Browser
Species Human (GRCh38)
Location 5:37865535-37865557
Sequence ACACACACAAATGGCACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989106214_989106216 2 Left 989106214 5:37865510-37865532 CCTCTGCACACGTGTGCACACGT No data
Right 989106216 5:37865535-37865557 ACACACACAAATGGCACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989106216 Original CRISPR ACACACACAAATGGCACTTC TGG Intergenic
No off target data available for this crispr