ID: 989110378

View in Genome Browser
Species Human (GRCh38)
Location 5:37901745-37901767
Sequence CTGGCAAAGGAGTGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989110368_989110378 19 Left 989110368 5:37901703-37901725 CCCTGGTTATATAGCATGTTGTG No data
Right 989110378 5:37901745-37901767 CTGGCAAAGGAGTGGGGAGGAGG No data
989110366_989110378 28 Left 989110366 5:37901694-37901716 CCAGCATACCCCTGGTTATATAG No data
Right 989110378 5:37901745-37901767 CTGGCAAAGGAGTGGGGAGGAGG No data
989110367_989110378 20 Left 989110367 5:37901702-37901724 CCCCTGGTTATATAGCATGTTGT No data
Right 989110378 5:37901745-37901767 CTGGCAAAGGAGTGGGGAGGAGG No data
989110369_989110378 18 Left 989110369 5:37901704-37901726 CCTGGTTATATAGCATGTTGTGG No data
Right 989110378 5:37901745-37901767 CTGGCAAAGGAGTGGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989110378 Original CRISPR CTGGCAAAGGAGTGGGGAGG AGG Intergenic
No off target data available for this crispr