ID: 989112745

View in Genome Browser
Species Human (GRCh38)
Location 5:37922969-37922991
Sequence CTGAGAACTCAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989112745_989112747 -10 Left 989112745 5:37922969-37922991 CCTTCTTCCTTCTGAGTTCTCAG No data
Right 989112747 5:37922982-37923004 GAGTTCTCAGTCTCAGTGAGTGG No data
989112745_989112748 3 Left 989112745 5:37922969-37922991 CCTTCTTCCTTCTGAGTTCTCAG No data
Right 989112748 5:37922995-37923017 CAGTGAGTGGCAGAAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989112745 Original CRISPR CTGAGAACTCAGAAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr