ID: 989114515

View in Genome Browser
Species Human (GRCh38)
Location 5:37939452-37939474
Sequence GGCTGAACAGAATTCCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989114512_989114515 13 Left 989114512 5:37939416-37939438 CCAAAATGGGTCTCACTGGGCTA No data
Right 989114515 5:37939452-37939474 GGCTGAACAGAATTCCTTTCTGG 0: 1
1: 0
2: 0
3: 19
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989114515 Original CRISPR GGCTGAACAGAATTCCTTTC TGG Intergenic
900267209 1:1763921-1763943 GCGTGAACAGAATTGCTTTGGGG - Intronic
904625507 1:31799827-31799849 GGCTGAAGAGGATTCTCTTCCGG - Exonic
907258118 1:53195798-53195820 GGCACAACAGAATTCCATTTTGG - Intergenic
909868990 1:80714776-80714798 GACAGGACTGAATTCCTTTCTGG + Intergenic
911087738 1:93993189-93993211 AGCTGCCCAGAGTTCCTTTCTGG + Exonic
912809768 1:112785190-112785212 GGCTTAAAATAATTCCTTGCCGG - Intergenic
913284038 1:117211015-117211037 GGCTGTGCAGAATTCCCTGCAGG + Intergenic
914671967 1:149877692-149877714 TGCTGAACAGAGTTCACTTCAGG + Intronic
915705446 1:157839264-157839286 GGCCCAGCAGACTTCCTTTCTGG - Intronic
916746395 1:167687923-167687945 GGCTGAAAAGCATTCCCATCTGG + Intronic
919669300 1:200324331-200324353 GGCTGAACTCAGTTCCTTGCAGG - Intergenic
919894425 1:202000197-202000219 GACTGGACAGAACTCCTATCTGG - Intronic
920447842 1:206033389-206033411 TGGTGAACTGCATTCCTTTCTGG + Intergenic
920576316 1:207063400-207063422 TGCTGAACAGAATTCCTTCAAGG + Exonic
921932363 1:220765137-220765159 GGGTGAACAGCATTGCTTCCGGG - Intronic
924714090 1:246556089-246556111 GGCTGAATAATATTCCATTCTGG - Intronic
1062931911 10:1358968-1358990 TGCTGAAAAGCATTCCTTTATGG + Intronic
1063245374 10:4212442-4212464 GGCTGTGCAGAATTCCTTGCTGG + Intergenic
1065685456 10:28280099-28280121 TGCTGAACTGAATTCCTGGCTGG - Exonic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1066149742 10:32603295-32603317 GGCTGAATAGTATTCCATTGTGG + Intronic
1067405392 10:46018584-46018606 GGCTAAACAGCCTTCCTTCCTGG - Intronic
1068618391 10:59148271-59148293 GGCTGAACTGTGTTCCTTTTTGG - Intergenic
1070828707 10:79405811-79405833 GGCAGATCAGATTTCTTTTCTGG - Intronic
1073381114 10:103078797-103078819 GGCTGAACAGACTTCCTACCTGG - Exonic
1074360754 10:112822540-112822562 GGCAGAAAAGAATCCCTTTTGGG - Intergenic
1076757631 10:132581208-132581230 GGCTGAATAGTAGTCCTTTGTGG + Intronic
1077996986 11:7462041-7462063 GACTGTTCAGAATTCATTTCTGG + Intronic
1079584478 11:22108759-22108781 GGATGAAAAGAAGTCATTTCAGG + Intergenic
1079986588 11:27206551-27206573 GGCAGGACTGAATTCCTTTCTGG - Intergenic
1082603187 11:55187217-55187239 GGCTGAAAAGTATCCCTTTGGGG + Intergenic
1083222583 11:61262994-61263016 GGCTAAATAGTATTCCATTCTGG - Intronic
1083596614 11:63920754-63920776 GGAGGAACCGAATTCCTGTCTGG - Intergenic
1083760108 11:64810966-64810988 GGCTGAACACATTTACTCTCTGG - Exonic
1084312756 11:68326381-68326403 GGCTGACCAGCAGCCCTTTCTGG + Intronic
1084774157 11:71364538-71364560 GGCTGAACAGAAGTGCACTCGGG + Intergenic
1085732952 11:79014669-79014691 GCATGAACAGGATTCTTTTCAGG + Intronic
1086369000 11:86137937-86137959 GGCTGAATAGTATTCCATTGTGG - Intergenic
1087002793 11:93437575-93437597 GGCTGCACAGCATTTCCTTCTGG + Exonic
1090802914 11:130184949-130184971 GGCTAAACAGATTTTTTTTCTGG - Intronic
1092128588 12:6092672-6092694 TGCTGACCAGCATTCCTTCCTGG + Intronic
1094297784 12:28927363-28927385 GGCTGATTAAAATTCCTATCTGG - Intergenic
1094789127 12:33890210-33890232 TGCAGAACAGAATTTCTTTCAGG - Intergenic
1095174769 12:39078950-39078972 GGCTGAACAGTATTCCATTGTGG - Intergenic
1095445689 12:42279850-42279872 GGCAGAACTGAATTCCTTGCAGG + Intronic
1100179556 12:92070630-92070652 GGCAGGACAGGAATCCTTTCAGG - Intronic
1101107913 12:101458046-101458068 GGCTACACAGCATTCCTATCAGG + Intergenic
1102402186 12:112639294-112639316 GGCTGCATAGGATTCCTTTGTGG - Intronic
1103226117 12:119289658-119289680 GGATGAATACAATCCCTTTCTGG - Intergenic
1103986733 12:124772355-124772377 GGCTGAAAACAATGCCTCTCGGG - Intergenic
1106468682 13:30035845-30035867 GGCCCACCTGAATTCCTTTCAGG + Intergenic
1110461756 13:75752777-75752799 GGCTGAATAGTATTCCATTGTGG + Intronic
1110605242 13:77424820-77424842 GGCTGAATAGTATTCCATTGTGG + Intergenic
1110899707 13:80805902-80805924 GGCTGAAGAGTATTCCATTACGG - Intergenic
1113435354 13:110286882-110286904 AGTTAAACAGAATTCGTTTCTGG + Intronic
1116369785 14:44115571-44115593 GGCTGAAGAGTATTCCATTGTGG + Intergenic
1116475484 14:45334169-45334191 GGCTGAATAGTATTCCATTGTGG + Intergenic
1117469218 14:56025066-56025088 CTAGGAACAGAATTCCTTTCAGG + Intergenic
1118855890 14:69622084-69622106 TGCTGCAAAGAATTCCTTTGGGG - Intronic
1119640336 14:76310017-76310039 GTCTGAAAAGATTTCCTTTTTGG - Intergenic
1121272071 14:92644439-92644461 GGAAGAACTGCATTCCTTTCTGG + Intronic
1126525864 15:49653401-49653423 AGCTGAACTGCATTCCTTTCTGG - Exonic
1127527984 15:59812840-59812862 GGCTGAACAAAAATCTTATCTGG + Intergenic
1130325355 15:82875167-82875189 TGGTGAGCAGGATTCCTTTCTGG - Intronic
1131445417 15:92494872-92494894 GGCTTAGCACAATTTCTTTCTGG + Intronic
1131601887 15:93857694-93857716 TGCTGAGCATAATTCCTTTCTGG + Intergenic
1132043205 15:98542471-98542493 AGCGGGACAGAATTTCTTTCTGG + Intergenic
1135482229 16:22830431-22830453 GGGTGAACAGAAATTCTTCCCGG - Intronic
1135805696 16:25540534-25540556 AGCAGCACAGAATTGCTTTCTGG - Intergenic
1136595211 16:31244188-31244210 GGCTGAACTGAATTGTTGTCAGG - Intergenic
1137377219 16:47962507-47962529 GGCTAAACAGAATTCCCTGGAGG + Intergenic
1138110979 16:54323675-54323697 AGCTGAACAGGGTTCCTTTGAGG + Intergenic
1150866953 17:68861412-68861434 GGCTGAATAAAAATCCTTTTTGG + Intergenic
1152554876 17:81048086-81048108 GGATAAACAGAATTCCTGGCCGG + Intronic
1153552763 18:6279468-6279490 TGCTGAACAGAATTCCTGAATGG + Intronic
1155207379 18:23572166-23572188 TCCTGGACAGAGTTCCTTTCAGG + Exonic
1157328021 18:46682920-46682942 TGCAGAACTGCATTCCTTTCTGG - Intronic
1158244620 18:55417598-55417620 GGATGTACAGAGTTCCTTTTTGG - Intronic
1158887958 18:61846680-61846702 GAATGTACAGAATACCTTTCTGG - Intronic
1161242308 19:3229172-3229194 GTGTGAACAGAATTCCTTGTAGG + Intronic
1164826257 19:31287012-31287034 GGCATAACGGAATTCATTTCTGG + Intronic
1166270429 19:41710199-41710221 AACAGATCAGAATTCCTTTCCGG + Intronic
925010916 2:485639-485661 GACTGAACAGATTTCCTCTTGGG + Intergenic
927587395 2:24319924-24319946 GGCTGACCTGAATGCCTTCCAGG - Intronic
928050816 2:27993307-27993329 AGATGAACAGATTTCCTTTAAGG + Intronic
931551171 2:63448659-63448681 GGCTGAATAGTATTCCATTGAGG - Intronic
934616563 2:95774875-95774897 GTCTCTACAGAAATCCTTTCCGG - Intergenic
934644329 2:96049684-96049706 GTCTCTACAGAAATCCTTTCCGG + Intergenic
934837745 2:97605774-97605796 GTCTCTACAGAAATCCTTTCCGG + Intergenic
934956576 2:98626726-98626748 AGAAGAACATAATTCCTTTCGGG + Intronic
935893007 2:107700430-107700452 CCCTGAACAGATTGCCTTTCAGG - Intergenic
937374196 2:121324065-121324087 GGCTGAGCTGAGTTCCTTTCTGG - Intergenic
939025885 2:137013652-137013674 TGCTGCACAGAATTCCCTTTTGG + Intronic
942469691 2:176246874-176246896 GTCTGAACCGAATTCCTTTTTGG - Intergenic
943026000 2:182629191-182629213 GGCAGGACTGAATTCCCTTCTGG - Intergenic
947474525 2:230430946-230430968 GGCTGGGCAGAATTTCTTTGGGG + Intronic
948114525 2:235484577-235484599 GGCTTAAAAGAATATCTTTCTGG - Intergenic
948945324 2:241216400-241216422 AGGGGAAAAGAATTCCTTTCTGG - Intronic
1169036754 20:2459447-2459469 AGCTGAACAGAATTACTATATGG - Intergenic
1170857674 20:20071996-20072018 GGATGTAAAGAATTCCTGTCTGG + Intronic
1171090965 20:22285482-22285504 TGCTGAACAGAATTCTTTAAGGG + Intergenic
1173020399 20:39262746-39262768 GGCTGAATAGTATTCCATTGTGG - Intergenic
1173231569 20:41202873-41202895 GGCTGAGGAGAATGCCTCTCAGG - Exonic
1175158106 20:56987871-56987893 GGAAGAACAGAATTTCTCTCCGG + Intergenic
1176762312 21:10814273-10814295 GGCTGAGAAGTATTCCTTTGGGG + Intergenic
1177427758 21:20947138-20947160 GGCTGGACTGTGTTCCTTTCTGG - Intergenic
1177550607 21:22615975-22615997 GGCTGAACAAAAATCTTGTCTGG - Intergenic
1181914089 22:26265300-26265322 GGCAGATCTGAATTCCTATCAGG - Intronic
949778241 3:7655802-7655824 GGGTAAACAGATTTCCATTCAGG - Intronic
952780633 3:37093715-37093737 GGTAAAACTGAATTCCTTTCAGG + Intronic
952901289 3:38113334-38113356 GGCTGTGCAGAATTCCCTTAGGG - Intronic
954977702 3:54712307-54712329 AGCTGAACTGTATTCCTTTCTGG + Intronic
955848936 3:63198065-63198087 GGCTCAACACAATTCCTTGAAGG - Intergenic
956957712 3:74359987-74360009 GGCTGCACAGAATAGATTTCTGG - Intronic
957118774 3:76061810-76061832 AGCAGGACTGAATTCCTTTCTGG + Intronic
957307687 3:78479577-78479599 GGCTGAACAATATTCTTTTTAGG + Intergenic
960723382 3:120646348-120646370 TGCTGAACCGCATTCCTCTCTGG + Exonic
961645250 3:128389394-128389416 GGCTGAACAGAAAATCTGTCTGG - Intronic
963624328 3:147651760-147651782 TGTTGAAAAGAATTCCTTTCTGG + Intergenic
963631306 3:147733816-147733838 GTATGAACAAAATACCTTTCAGG + Intergenic
963955944 3:151253778-151253800 GGCTGTCCAGGATTACTTTCTGG + Intronic
965477152 3:169170785-169170807 GGGTTAATAGAATTCCTTTTCGG - Intronic
966376086 3:179297223-179297245 GTCTGACCAATATTCCTTTCTGG - Intergenic
966590553 3:181677879-181677901 GGCTGAATAGTATTCCATTTAGG + Intergenic
966926993 3:184651107-184651129 AGCTGGACAGGAGTCCTTTCTGG - Intronic
967346940 3:188467825-188467847 GGCAGGGCAGCATTCCTTTCTGG - Intronic
967494570 3:190128548-190128570 CGCTGAAAGGAATTCCTGTCTGG - Intergenic
968592102 4:1464408-1464430 GCCTGAATTAAATTCCTTTCAGG - Intergenic
972045507 4:34660830-34660852 GGCTGACTAGAATTCCATTGTGG + Intergenic
973312738 4:48727185-48727207 TGCTATACAGTATTCCTTTCTGG - Intronic
977041017 4:92018879-92018901 GGCTGATCACAAGTGCTTTCAGG - Intergenic
977567827 4:98598899-98598921 AACAGAACAGAATTACTTTCTGG - Intronic
982912531 4:161162775-161162797 GGCTGAATAGTATTCCATTGAGG + Intergenic
983325733 4:166253661-166253683 GGCTGAATAGTATTCCATTGCGG + Intergenic
983453455 4:167934329-167934351 GGTAGAAGAGAATTCCTCTCTGG - Intergenic
983490420 4:168383393-168383415 GGCTGAGCAGAATACTTTTTGGG - Intronic
986095461 5:4549715-4549737 GGCTGAACCTATTCCCTTTCAGG - Intergenic
986889043 5:12277609-12277631 AGGTGAACAGAATGCCTTTGTGG + Intergenic
988995050 5:36706659-36706681 GGCAGAGCTGAGTTCCTTTCTGG - Intergenic
989114515 5:37939452-37939474 GGCTGAACAGAATTCCTTTCTGG + Intergenic
989765467 5:45077513-45077535 GGCTGAAGGAAATTACTTTCTGG + Intergenic
990683914 5:58278324-58278346 GGCAGAAGCGAATTCCTTGCGGG - Intergenic
993046776 5:82875566-82875588 GGCTGAACAGTATTGCATTGCGG + Intergenic
995357357 5:111254395-111254417 GTCTGCACAGAATCCCTTCCTGG + Intronic
996210392 5:120801558-120801580 GGCTGAAGAGAACTACTTTGGGG - Intergenic
997866271 5:137466249-137466271 GACTGACCAGAATTTCTTCCTGG + Intronic
998639184 5:143990327-143990349 GACTGAAAAGAATTCATTTTTGG + Intergenic
999403513 5:151285899-151285921 GGCAGAGCAGCATTCCTTTCTGG - Intronic
999962168 5:156767512-156767534 GGCTGAACTCAATTACTTTATGG - Intronic
1001789664 5:174445188-174445210 GGGTGAAAAGAGCTCCTTTCTGG - Intergenic
1002528765 5:179831044-179831066 GGCAGAACAAAGTTACTTTCTGG + Intronic
1005153084 6:22775205-22775227 GGCTGACCTGGATTCCTTCCAGG + Intergenic
1006312350 6:33269747-33269769 GATTGAACAGAAATCCATTCGGG - Exonic
1008881553 6:56385354-56385376 GGCAGAGCTGCATTCCTTTCTGG + Intronic
1009477021 6:64105563-64105585 GGCTGAACAGAAGACTTTTAAGG - Intronic
1012076864 6:94698935-94698957 GGCAGAACTGAATGCCTTCCAGG - Intergenic
1012460546 6:99455674-99455696 GGCTGAAGAGTATTCCATTATGG - Intronic
1014811613 6:125893070-125893092 GGCTCAACAGAAGTCCTTAAGGG + Intronic
1016405224 6:143722950-143722972 GGCTGAATAGTATTCCATTATGG + Intronic
1017713912 6:157194546-157194568 GACTGAACACAATTTCCTTCAGG + Intronic
1019844589 7:3484846-3484868 GGCTGAATAGTATTCCTTTGTGG + Intronic
1021947203 7:25739803-25739825 AGCTGAGAAGTATTCCTTTCTGG + Intergenic
1022564553 7:31384888-31384910 GGCTGGCCAGAATGCCTTCCAGG - Intergenic
1022868674 7:34451294-34451316 TGTTGACCAGAACTCCTTTCAGG - Intergenic
1022979618 7:35592292-35592314 TGCTTCCCAGAATTCCTTTCTGG + Intergenic
1023352126 7:39331123-39331145 GGCTAAACAGTATTCCGTTATGG + Intronic
1027721416 7:81746712-81746734 GGGTGAATAGAATTATTTTCTGG + Intronic
1027845548 7:83369468-83369490 GGCTGAAAAAAATGCCTTTGGGG - Intronic
1027920856 7:84392413-84392435 GGCTGAATAGTATTCCATTGGGG + Intronic
1032742161 7:134749725-134749747 GGCGAAACAGAATTCCTTCATGG - Intronic
1033183581 7:139204286-139204308 GGCAGGACTGCATTCCTTTCTGG - Intergenic
1037072070 8:14663040-14663062 GGCAGAACTGCATTTCTTTCTGG - Intronic
1037379268 8:18266910-18266932 GGCAGAACTGAATTCCTCACAGG - Intergenic
1038817730 8:30922885-30922907 GGGTAAACAGAATTGCTTTTAGG - Intergenic
1039331618 8:36543498-36543520 GGGCAAACAGAATTGCTTTCAGG - Intergenic
1039665867 8:39527171-39527193 GGCTGAAAAGTATTCCATTGTGG - Intergenic
1045099754 8:98832488-98832510 AACTGACCAGCATTCCTTTCTGG - Intronic
1045853707 8:106736283-106736305 GGCTGGACAGATTTCCATTCTGG - Intronic
1047634621 8:126747153-126747175 GGCTGCATAGTATTCCTTTTGGG - Intergenic
1049041970 8:140119334-140119356 GGCAAAACAGAAGTCCTTTCAGG + Intronic
1051135318 9:13913677-13913699 GGCTGAACAGTATTCCATTGTGG + Intergenic
1051303752 9:15684687-15684709 TGCTGAACTGAATGCATTTCTGG - Intronic
1052077883 9:24166587-24166609 GGCTTAACATAATGCCTTCCAGG + Intergenic
1052486962 9:29113979-29114001 TGTGGAAAAGAATTCCTTTCTGG - Intergenic
1055728632 9:79258211-79258233 GGCTGTATCGATTTCCTTTCTGG - Intergenic
1056741544 9:89260164-89260186 GGCTGAACACTATTCCATTGTGG - Intergenic
1056997491 9:91477152-91477174 GGCTGGGCTGAATTCCTGTCTGG + Intergenic
1057341290 9:94204131-94204153 GGCTGAATAGTATTCCATTGGGG - Intergenic
1059462555 9:114443345-114443367 AGCAGGACAGAGTTCCTTTCTGG + Intronic
1060111756 9:120911513-120911535 GGCTGAACAGTCTTCCCTACAGG - Exonic
1185789256 X:2916170-2916192 GGCTGAATAGTATTCCATTGTGG - Intronic
1186105044 X:6196617-6196639 GGATGAACAGAGTTCTTTTCAGG - Intronic
1186325493 X:8472181-8472203 GGCTGAAAAACCTTCCTTTCGGG + Intergenic
1189370486 X:40424276-40424298 GGCTGAATGGTATTCCTTTATGG + Intergenic
1189429167 X:40932030-40932052 GGATGAACAGAATTCCCTAAAGG + Intergenic
1192851748 X:74963841-74963863 GGCTGAGGTGCATTCCTTTCTGG + Intergenic
1193206865 X:78759604-78759626 GGCTGAACAGATTTACATTAAGG + Intergenic
1194581980 X:95684595-95684617 GGCAGAGCTGCATTCCTTTCTGG - Intergenic
1198476779 X:137002029-137002051 AGCTGAACTGAATGCCTTCCAGG + Intergenic
1200375976 X:155780655-155780677 GGCTTAACAGAATTAGTTTGGGG + Exonic