ID: 989115411

View in Genome Browser
Species Human (GRCh38)
Location 5:37948045-37948067
Sequence TGTCCACTTGTTCAAGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989115404_989115411 11 Left 989115404 5:37948011-37948033 CCCAGTATATAGCCAGTGCCTGC No data
Right 989115411 5:37948045-37948067 TGTCCACTTGTTCAAGTGTGGGG No data
989115407_989115411 -1 Left 989115407 5:37948023-37948045 CCAGTGCCTGCTGAGGTTTATTT No data
Right 989115411 5:37948045-37948067 TGTCCACTTGTTCAAGTGTGGGG No data
989115408_989115411 -7 Left 989115408 5:37948029-37948051 CCTGCTGAGGTTTATTTGTCCAC No data
Right 989115411 5:37948045-37948067 TGTCCACTTGTTCAAGTGTGGGG No data
989115403_989115411 16 Left 989115403 5:37948006-37948028 CCATACCCAGTATATAGCCAGTG No data
Right 989115411 5:37948045-37948067 TGTCCACTTGTTCAAGTGTGGGG No data
989115405_989115411 10 Left 989115405 5:37948012-37948034 CCAGTATATAGCCAGTGCCTGCT No data
Right 989115411 5:37948045-37948067 TGTCCACTTGTTCAAGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989115411 Original CRISPR TGTCCACTTGTTCAAGTGTG GGG Intergenic
No off target data available for this crispr