ID: 989115543

View in Genome Browser
Species Human (GRCh38)
Location 5:37948992-37949014
Sequence CACCATGGGCAACTGGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989115537_989115543 8 Left 989115537 5:37948961-37948983 CCAATAAATGATGTGTTATCAAA No data
Right 989115543 5:37948992-37949014 CACCATGGGCAACTGGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989115543 Original CRISPR CACCATGGGCAACTGGACCT TGG Intergenic
No off target data available for this crispr