ID: 989117284

View in Genome Browser
Species Human (GRCh38)
Location 5:37967404-37967426
Sequence AACTTTATGCTGCTACTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989117280_989117284 26 Left 989117280 5:37967355-37967377 CCACATTATATATACAGATCATC No data
Right 989117284 5:37967404-37967426 AACTTTATGCTGCTACTGGTTGG No data
989117282_989117284 -1 Left 989117282 5:37967382-37967404 CCTAGCAGTGCAGAGGTTTTTGA No data
Right 989117284 5:37967404-37967426 AACTTTATGCTGCTACTGGTTGG No data
989117279_989117284 27 Left 989117279 5:37967354-37967376 CCCACATTATATATACAGATCAT No data
Right 989117284 5:37967404-37967426 AACTTTATGCTGCTACTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989117284 Original CRISPR AACTTTATGCTGCTACTGGT TGG Intergenic
No off target data available for this crispr