ID: 989120869

View in Genome Browser
Species Human (GRCh38)
Location 5:38003252-38003274
Sequence ATACTGATCTCAAGGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989120869_989120875 10 Left 989120869 5:38003252-38003274 CCATCTGTCCTTGAGATCAGTAT No data
Right 989120875 5:38003285-38003307 TCATTGCTTGGTTGAAGATTAGG No data
989120869_989120872 -2 Left 989120869 5:38003252-38003274 CCATCTGTCCTTGAGATCAGTAT No data
Right 989120872 5:38003273-38003295 ATGGAGCCCAAATCATTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989120869 Original CRISPR ATACTGATCTCAAGGACAGA TGG (reversed) Intergenic
No off target data available for this crispr