ID: 989120942

View in Genome Browser
Species Human (GRCh38)
Location 5:38004008-38004030
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989120942_989120950 24 Left 989120942 5:38004008-38004030 CCTAGCCCATCAGAGGTCAGATT No data
Right 989120950 5:38004055-38004077 ACATGCATGGCTGCTTCCCTGGG No data
989120942_989120952 26 Left 989120942 5:38004008-38004030 CCTAGCCCATCAGAGGTCAGATT No data
Right 989120952 5:38004057-38004079 ATGCATGGCTGCTTCCCTGGGGG No data
989120942_989120951 25 Left 989120942 5:38004008-38004030 CCTAGCCCATCAGAGGTCAGATT No data
Right 989120951 5:38004056-38004078 CATGCATGGCTGCTTCCCTGGGG No data
989120942_989120948 11 Left 989120942 5:38004008-38004030 CCTAGCCCATCAGAGGTCAGATT No data
Right 989120948 5:38004042-38004064 GAGTTGTCTAAGAACATGCATGG No data
989120942_989120949 23 Left 989120942 5:38004008-38004030 CCTAGCCCATCAGAGGTCAGATT No data
Right 989120949 5:38004054-38004076 AACATGCATGGCTGCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989120942 Original CRISPR AATCTGACCTCTGATGGGCT AGG (reversed) Intergenic