ID: 989120944

View in Genome Browser
Species Human (GRCh38)
Location 5:38004014-38004036
Sequence GGGGATAATCTGACCTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989120944_989120951 19 Left 989120944 5:38004014-38004036 CCATCAGAGGTCAGATTATCCCC No data
Right 989120951 5:38004056-38004078 CATGCATGGCTGCTTCCCTGGGG No data
989120944_989120953 29 Left 989120944 5:38004014-38004036 CCATCAGAGGTCAGATTATCCCC No data
Right 989120953 5:38004066-38004088 TGCTTCCCTGGGGGCTTCCTCGG No data
989120944_989120952 20 Left 989120944 5:38004014-38004036 CCATCAGAGGTCAGATTATCCCC No data
Right 989120952 5:38004057-38004079 ATGCATGGCTGCTTCCCTGGGGG No data
989120944_989120949 17 Left 989120944 5:38004014-38004036 CCATCAGAGGTCAGATTATCCCC No data
Right 989120949 5:38004054-38004076 AACATGCATGGCTGCTTCCCTGG No data
989120944_989120950 18 Left 989120944 5:38004014-38004036 CCATCAGAGGTCAGATTATCCCC No data
Right 989120950 5:38004055-38004077 ACATGCATGGCTGCTTCCCTGGG No data
989120944_989120948 5 Left 989120944 5:38004014-38004036 CCATCAGAGGTCAGATTATCCCC No data
Right 989120948 5:38004042-38004064 GAGTTGTCTAAGAACATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989120944 Original CRISPR GGGGATAATCTGACCTCTGA TGG (reversed) Intergenic