ID: 989120946

View in Genome Browser
Species Human (GRCh38)
Location 5:38004034-38004056
Sequence GTTCTTAGACAACTCAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989120946_989120949 -3 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 989120949 5:38004054-38004076 AACATGCATGGCTGCTTCCCTGG No data
989120946_989120958 24 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 989120958 5:38004081-38004103 TTCCTCGGTTGCGGGCATGATGG No data
989120946_989120960 27 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 989120960 5:38004084-38004106 CTCGGTTGCGGGCATGATGGAGG No data
989120946_989120950 -2 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 989120950 5:38004055-38004077 ACATGCATGGCTGCTTCCCTGGG No data
989120946_989120952 0 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 989120952 5:38004057-38004079 ATGCATGGCTGCTTCCCTGGGGG No data
989120946_989120957 16 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 989120957 5:38004073-38004095 CTGGGGGCTTCCTCGGTTGCGGG No data
989120946_989120956 15 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 989120956 5:38004072-38004094 CCTGGGGGCTTCCTCGGTTGCGG No data
989120946_989120953 9 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 989120953 5:38004066-38004088 TGCTTCCCTGGGGGCTTCCTCGG No data
989120946_989120951 -1 Left 989120946 5:38004034-38004056 CCCTCTCTGAGTTGTCTAAGAAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 989120951 5:38004056-38004078 CATGCATGGCTGCTTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989120946 Original CRISPR GTTCTTAGACAACTCAGAGA GGG (reversed) Intergenic