ID: 989120947

View in Genome Browser
Species Human (GRCh38)
Location 5:38004035-38004057
Sequence TGTTCTTAGACAACTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989120947_989120953 8 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120953 5:38004066-38004088 TGCTTCCCTGGGGGCTTCCTCGG No data
989120947_989120951 -2 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120951 5:38004056-38004078 CATGCATGGCTGCTTCCCTGGGG No data
989120947_989120950 -3 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120950 5:38004055-38004077 ACATGCATGGCTGCTTCCCTGGG No data
989120947_989120957 15 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120957 5:38004073-38004095 CTGGGGGCTTCCTCGGTTGCGGG No data
989120947_989120956 14 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120956 5:38004072-38004094 CCTGGGGGCTTCCTCGGTTGCGG No data
989120947_989120958 23 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120958 5:38004081-38004103 TTCCTCGGTTGCGGGCATGATGG No data
989120947_989120952 -1 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120952 5:38004057-38004079 ATGCATGGCTGCTTCCCTGGGGG No data
989120947_989120949 -4 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120949 5:38004054-38004076 AACATGCATGGCTGCTTCCCTGG No data
989120947_989120960 26 Left 989120947 5:38004035-38004057 CCTCTCTGAGTTGTCTAAGAACA No data
Right 989120960 5:38004084-38004106 CTCGGTTGCGGGCATGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989120947 Original CRISPR TGTTCTTAGACAACTCAGAG AGG (reversed) Intergenic