ID: 989120948

View in Genome Browser
Species Human (GRCh38)
Location 5:38004042-38004064
Sequence GAGTTGTCTAAGAACATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989120940_989120948 13 Left 989120940 5:38004006-38004028 CCCCTAGCCCATCAGAGGTCAGA No data
Right 989120948 5:38004042-38004064 GAGTTGTCTAAGAACATGCATGG No data
989120941_989120948 12 Left 989120941 5:38004007-38004029 CCCTAGCCCATCAGAGGTCAGAT No data
Right 989120948 5:38004042-38004064 GAGTTGTCTAAGAACATGCATGG No data
989120943_989120948 6 Left 989120943 5:38004013-38004035 CCCATCAGAGGTCAGATTATCCC No data
Right 989120948 5:38004042-38004064 GAGTTGTCTAAGAACATGCATGG No data
989120942_989120948 11 Left 989120942 5:38004008-38004030 CCTAGCCCATCAGAGGTCAGATT No data
Right 989120948 5:38004042-38004064 GAGTTGTCTAAGAACATGCATGG No data
989120944_989120948 5 Left 989120944 5:38004014-38004036 CCATCAGAGGTCAGATTATCCCC No data
Right 989120948 5:38004042-38004064 GAGTTGTCTAAGAACATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989120948 Original CRISPR GAGTTGTCTAAGAACATGCA TGG Intergenic